Mutagenetix > Incidental Mutation

Incidental Mutation 'R6622:Clock'

524505

Institutional Source

Beutler Lab

Gene Symbol

Clock

Ensembl Gene

ENSMUSG00000029238

Gene Name

circadian locomotor output cycles kaput

Synonyms

5330400M04Rik, bHLHe8, KAT13D

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.631) question?

Stock #

R6622 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76209868-76304792 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 76241954 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 349 (I349K)

Ref Sequence

ENSEMBL: ENSMUSP00000143939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202651]

AlphaFold

O08785

Predicted Effect

probably damaging
Transcript: ENSMUST00000075159
AA Change: I349K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238
AA Change: I349K

Domain	Start	End	E-Value	Type
HLH	40	90	7.77e-12	SMART
PAS	109	175	1.88e-6	SMART
PAS	264	330	3.65e-4	SMART
PAC	336	379	7.63e-7	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	634	N/A	INTRINSIC
low complexity region	640	657	N/A	INTRINSIC
low complexity region	738	796	N/A	INTRINSIC
low complexity region	818	837	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202122
AA Change: I349K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238
AA Change: I349K

Domain	Start	End	E-Value	Type
TFS2N	34	106	4.1e-3	SMART
HLH	40	90	3.4e-14	SMART
PAS	109	175	9.6e-9	SMART
PAS	264	330	1.8e-6	SMART
PAC	336	379	3.9e-9	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	633	N/A	INTRINSIC
low complexity region	639	656	N/A	INTRINSIC
low complexity region	737	795	N/A	INTRINSIC
low complexity region	817	836	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202651
AA Change: I349K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238
AA Change: I349K

Domain	Start	End	E-Value	Type
HLH	40	90	7.77e-12	SMART
PAS	109	175	1.88e-6	SMART
PAS	264	330	3.65e-4	SMART
PAC	336	379	7.63e-7	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	634	N/A	INTRINSIC
low complexity region	640	657	N/A	INTRINSIC
low complexity region	738	796	N/A	INTRINSIC
low complexity region	818	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202857

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,244,222	A2563D	probably damaging	Het
6030419C18Rik	A	G	9: 58,499,250	I148V	probably benign	Het
Adgrl3	A	C	5: 81,794,759	D1412A	probably benign	Het
Arhgap26	A	G	18: 38,899,863		probably benign	Het
Card14	A	G	11: 119,333,988	M614V	probably benign	Het
Cbx2	A	G	11: 119,029,135	T509A	probably damaging	Het
Cep135	A	G	5: 76,640,968	D1136G	probably benign	Het
Cep170	T	A	1: 176,756,332	Q827L	probably damaging	Het
Cnppd1	A	T	1: 75,136,895	V243E	probably damaging	Het
Cops3	A	G	11: 59,833,134	F93L	probably damaging	Het
Cxxc5	T	G	18: 35,859,319	C258G	possibly damaging	Het
Cycs	G	A	6: 50,566,463		probably benign	Het
Cyp2c40	A	T	19: 39,802,546	H280Q	probably damaging	Het
Cyp4f14	C	T	17: 32,914,645	R79H	probably benign	Het
Dnajc27	A	G	12: 4,103,114	S197G	probably benign	Het
Dscam	C	T	16: 96,645,073	G1456E	probably benign	Het
Dst	G	A	1: 34,179,251	V1591I	probably benign	Het
Epha5	A	G	5: 84,237,528	S315P	possibly damaging	Het
Fam46a	G	T	9: 85,326,456	R105S	probably damaging	Het
Frmd4a	A	G	2: 4,606,062	T1012A	probably benign	Het
Fxr2	G	A	11: 69,641,590		probably null	Het
Gm12394	T	A	4: 42,793,111	L340F	probably damaging	Het
Hcn4	T	A	9: 58,857,727	V534E	unknown	Het
Hrh4	A	G	18: 13,022,397	Y331C	probably damaging	Het
Kif16b	T	A	2: 142,712,442	H812L	probably benign	Het
Krt14	T	A	11: 100,203,960	R451S	probably benign	Het
Man2b1	A	G	8: 85,084,479	T80A	probably damaging	Het
Nedd4l	A	G	18: 65,174,234	T383A	probably damaging	Het
Pcdha9	T	A	18: 36,998,654	L259M	possibly damaging	Het
Pdgfd	T	C	9: 6,293,818	C131R	probably damaging	Het
Prrc2a	C	G	17: 35,155,420	R1418P	probably damaging	Het
Ptpa	G	T	2: 30,437,577	E114D	probably damaging	Het
Ptprt	A	T	2: 161,553,840	C1157S	probably damaging	Het
Rnf126	A	T	10: 79,761,563		probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sel1l3	A	G	5: 53,139,860	V748A	probably damaging	Het
Serinc5	T	A	13: 92,688,686	S208T	probably benign	Het
Sftpb	A	G	6: 72,305,655	I74V	possibly damaging	Het
Slc22a14	A	C	9: 119,170,577	I516S	possibly damaging	Het
Slco2a1	G	A	9: 103,074,505	C411Y	possibly damaging	Het
Tet3	G	A	6: 83,403,444	P581S	probably benign	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Tnrc6b	T	A	15: 80,879,184	W296R	probably damaging	Het
Trpm1	T	A	7: 64,240,595	L982H	probably damaging	Het
Ttn	C	A	2: 76,720,518	R23183I	possibly damaging	Het
Tuft1	T	A	3: 94,635,419	Y46F	probably damaging	Het
Vmn1r167	T	A	7: 23,505,589	M1L	probably null	Het
Zfp808	A	G	13: 62,171,832	R292G	possibly damaging	Het
Zp2	T	C	7: 120,132,525	E669G	probably benign	Het
Zp2	C	T	7: 120,141,913	M129I	probably benign	Het

Other mutations in Clock

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00598:Clock	APN	5	76229464	missense	probably benign	0.17
IGL00725:Clock	APN	5	76254413	nonsense	probably null
IGL01304:Clock	APN	5	76266355	critical splice donor site	probably null
IGL01369:Clock	APN	5	76237086	missense	probably benign	0.30
IGL01542:Clock	APN	5	76231475	missense	possibly damaging	0.82
IGL02541:Clock	APN	5	76262672	splice site	probably null
IGL02602:Clock	APN	5	76254426	missense	probably null	1.00
IGL02602:Clock	APN	5	76254427	missense	probably damaging	1.00
IGL03186:Clock	APN	5	76243082	missense	probably damaging	0.98
IGL03309:Clock	APN	5	76231394	critical splice donor site	probably null
R6760_Clock_188	UTSW	5	76226976	missense	unknown
uhr	UTSW	5	76229554	nonsense	probably null
R0304:Clock	UTSW	5	76226985	missense	unknown
R0593:Clock	UTSW	5	76265836	missense	probably benign	0.25
R0654:Clock	UTSW	5	76227129	missense	possibly damaging	0.95
R0684:Clock	UTSW	5	76245518	missense	probably damaging	0.96
R0707:Clock	UTSW	5	76227129	missense	possibly damaging	0.95
R0751:Clock	UTSW	5	76229361	missense	possibly damaging	0.75
R0865:Clock	UTSW	5	76266424	splice site	probably benign
R0920:Clock	UTSW	5	76230320	missense	possibly damaging	0.80
R1396:Clock	UTSW	5	76266802	missense	probably benign	0.00
R1450:Clock	UTSW	5	76262731	nonsense	probably null
R1487:Clock	UTSW	5	76266354	splice site	probably null
R1574:Clock	UTSW	5	76242832	missense	probably damaging	1.00
R1574:Clock	UTSW	5	76242832	missense	probably damaging	1.00
R1858:Clock	UTSW	5	76240909	missense	possibly damaging	0.92
R1872:Clock	UTSW	5	76248462	missense	possibly damaging	0.67
R1905:Clock	UTSW	5	76266888	splice site	probably benign
R1937:Clock	UTSW	5	76229493	missense	probably damaging	0.99
R2411:Clock	UTSW	5	76231513	missense	probably benign	0.08
R2887:Clock	UTSW	5	76245273	missense	probably damaging	0.99
R3410:Clock	UTSW	5	76229554	nonsense	probably null
R4514:Clock	UTSW	5	76230199	missense	probably benign	0.00
R4598:Clock	UTSW	5	76235810	missense	probably benign	0.00
R4599:Clock	UTSW	5	76235810	missense	probably benign	0.00
R4795:Clock	UTSW	5	76265916	missense	probably damaging	1.00
R4796:Clock	UTSW	5	76265916	missense	probably damaging	1.00
R4973:Clock	UTSW	5	76254411	missense	possibly damaging	0.62
R5204:Clock	UTSW	5	76243170	splice site	probably null
R5271:Clock	UTSW	5	76241954	missense	probably damaging	1.00
R5547:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5630:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5631:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5632:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5787:Clock	UTSW	5	76237051	missense	probably damaging	1.00
R6274:Clock	UTSW	5	76237153	missense	probably benign	0.45
R6578:Clock	UTSW	5	76216709	missense	unknown
R6760:Clock	UTSW	5	76226976	missense	unknown
R6793:Clock	UTSW	5	76237120	frame shift	probably null
R7406:Clock	UTSW	5	76266845	start codon destroyed	probably null	0.26
R7414:Clock	UTSW	5	76262764	missense	probably benign	0.00
R7560:Clock	UTSW	5	76242891	splice site	probably null
R7593:Clock	UTSW	5	76236298	missense	possibly damaging	0.80
R7640:Clock	UTSW	5	76248378	missense	possibly damaging	0.71
R7708:Clock	UTSW	5	76266409	missense	probably benign	0.00
R7713:Clock	UTSW	5	76245420	critical splice donor site	probably null
R7807:Clock	UTSW	5	76243135	missense	probably benign	0.01
R8171:Clock	UTSW	5	76266414	missense	possibly damaging	0.94
R8190:Clock	UTSW	5	76227204	missense	probably damaging	0.98
R8225:Clock	UTSW	5	76241912	missense	probably damaging	0.99
R8309:Clock	UTSW	5	76254422	missense	probably benign	0.07
R8557:Clock	UTSW	5	76229370	missense	probably damaging	1.00
R8792:Clock	UTSW	5	76262727	missense	probably damaging	1.00
R8869:Clock	UTSW	5	76227042	small deletion	probably benign
R8870:Clock	UTSW	5	76235785	missense	probably benign	0.17
R8980:Clock	UTSW	5	76254439	missense	probably benign	0.01
R8982:Clock	UTSW	5	76216712	missense	unknown
R9177:Clock	UTSW	5	76229409	missense	probably benign	0.00
R9208:Clock	UTSW	5	76237024	missense	probably benign	0.00
R9213:Clock	UTSW	5	76245529	missense	possibly damaging	0.94
R9307:Clock	UTSW	5	76216824	missense	unknown
R9446:Clock	UTSW	5	76248441	missense	probably benign	0.00
R9516:Clock	UTSW	5	76229380	missense	possibly damaging	0.85
R9572:Clock	UTSW	5	76229491	missense	probably benign	0.00
R9630:Clock	UTSW	5	76245434	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGGGCAAGATCACTATCACTC -3'
(R):5'- GGCCAGTTAACAGTATGACTTTCAG -3'

Sequencing Primer
(F):5'- CACCTTACAAATGTTCTTCCAG -3'
(R):5'- CTGACTATAAAATTGGAATCTGGGAG -3'

Posted On

2018-06-22