Incidental Mutation 'R5623:G6pc2'
ID441669
Institutional Source Beutler Lab
Gene Symbol G6pc2
Ensembl Gene ENSMUSG00000005232
Gene Nameglucose-6-phosphatase, catalytic, 2
SynonymsIGRP, G6pc-rs, islet specific glucose-6-phosphatase
MMRRC Submission 043162-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5623 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69211073-69227841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69226583 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 191 (E191G)
Ref Sequence ENSEMBL: ENSMUSP00000005364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005364] [ENSMUST00000112317]
Predicted Effect probably damaging
Transcript: ENSMUST00000005364
AA Change: E191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005364
Gene: ENSMUSG00000005232
AA Change: E191G

DomainStartEndE-ValueType
acidPPc 53 194 7.83e-21 SMART
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 254 273 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000112317
SMART Domains Protein: ENSMUSP00000107936
Gene: ENSMUSG00000005232

DomainStartEndE-ValueType
SCOP:d1d2ta_ 6 126 5e-13 SMART
Blast:acidPPc 53 147 1e-65 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151953
Meta Mutation Damage Score 0.2299 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes an enzyme that belongs to the glucose-6-phosphatase catalytic subunit family. Members of this family catalyze the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, to release glucose into the bloodstream. The family member encoded by this gene is found specifically in pancreatic islets but has not been shown to have phosphotransferase or phosphatase activity exhibited by a similar liver enzyme. The non-obese diabetic (NOD) mouse is a model for human type 1 diabetes, an autoimmune disease in which T lymphocytes attack and destroy insulin-producing pancreatic beta cells. In NOD mice, the protein encoded by this gene is a major target of cell-mediated autoimmunity. Variations in the human and mouse genes are associated with lower fasting plasma glucose levels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a disruption of this gene show a significant drop in fasting blood glucose. Females also show a significant drop in plasma triacylglycerol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,546,094 Q772P possibly damaging Het
B3gnt2 C G 11: 22,837,018 A57P probably damaging Het
BC067074 T C 13: 113,346,634 I1590T possibly damaging Het
Birc6 T G 17: 74,528,656 D63E probably damaging Het
Ccdc13 T C 9: 121,833,733 E72G probably damaging Het
Cfap221 C T 1: 119,954,168 A297T probably benign Het
Chd1 T A 17: 15,754,932 N1081K probably damaging Het
Chrm3 C A 13: 9,877,387 V538L possibly damaging Het
Clec16a T A 16: 10,611,121 N37K probably benign Het
Cnksr3 T A 10: 7,120,548 I229F probably damaging Het
Dchs1 T C 7: 105,772,769 E148G probably damaging Het
Diaph1 A T 18: 37,896,093 probably benign Het
Dis3l A G 9: 64,307,603 F895L possibly damaging Het
Dnah1 G T 14: 31,286,023 D2142E possibly damaging Het
Dst T C 1: 34,190,133 V1944A possibly damaging Het
Eif4a2 C T 16: 23,110,219 probably benign Het
Ephb6 T A 6: 41,616,481 M487K probably benign Het
Fgf18 T G 11: 33,134,272 T61P probably damaging Het
Gm10717 C T 9: 3,026,318 S55L probably benign Het
Gm5414 A G 15: 101,625,811 F286S probably damaging Het
Gpcpd1 G T 2: 132,534,717 A553E probably damaging Het
Gpr153 A G 4: 152,281,941 D321G possibly damaging Het
Hecw2 T A 1: 53,832,623 Q1388L probably null Het
Ighv14-3 A C 12: 114,060,090 S36A probably damaging Het
Inpp5j C A 11: 3,494,766 G969V probably damaging Het
Kat5 G A 19: 5,607,562 R307W probably damaging Het
Klk1b21 A G 7: 44,105,565 S95G probably damaging Het
Mdm1 G A 10: 118,150,789 V171I possibly damaging Het
Nfu1 TCGC T 6: 87,016,206 probably benign Het
Olfr175-ps1 C T 16: 58,824,343 R122H probably benign Het
Olfr776 G A 10: 129,261,032 V24M probably benign Het
Phkb T A 8: 85,843,048 probably benign Het
Pkd1l3 A T 8: 109,623,719 T399S possibly damaging Het
Prr14l A T 5: 32,844,508 probably benign Het
Psg21 A C 7: 18,655,014 L51R probably damaging Het
Ptprg T A 14: 12,153,857 I526N probably damaging Het
Rab1a T C 11: 20,201,626 probably benign Het
Rims2 A T 15: 39,478,615 Q620L probably damaging Het
Rnf215 T G 11: 4,135,453 S58A probably benign Het
Scaper A C 9: 55,864,507 V375G probably benign Het
Sgk3 A T 1: 9,802,295 probably benign Het
Skiv2l T C 17: 34,847,432 K192E probably benign Het
Slc34a3 T A 2: 25,233,300 probably null Het
Sspn T A 6: 145,961,226 C52S probably damaging Het
Strip1 T C 3: 107,626,826 E164G possibly damaging Het
Sult5a1 A C 8: 123,157,442 S47A probably damaging Het
Svep1 T C 4: 58,091,964 D1557G possibly damaging Het
Tdrd6 T C 17: 43,629,333 I275V probably damaging Het
Thada C T 17: 84,191,983 V1929I probably benign Het
Tmem132b G A 5: 125,623,352 R318Q probably damaging Het
Tmem176b T G 6: 48,834,070 I259L probably benign Het
Tmppe C A 9: 114,405,896 P421Q possibly damaging Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Tpcn2 T A 7: 145,267,334 R328W possibly damaging Het
Trem1 C T 17: 48,237,055 T36I probably damaging Het
Trpm2 C A 10: 77,932,139 R842L probably damaging Het
Zfp319 A G 8: 95,325,571 probably benign Het
Other mutations in G6pc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:G6pc2 APN 2 69222967 missense probably damaging 1.00
IGL02031:G6pc2 APN 2 69222991 missense probably benign 0.36
IGL02504:G6pc2 APN 2 69226595 missense probably damaging 0.99
IGL02674:G6pc2 APN 2 69226566 critical splice acceptor site probably null
IGL03339:G6pc2 APN 2 69220895 splice site probably benign
R0011:G6pc2 UTSW 2 69226565 splice site probably benign
R1113:G6pc2 UTSW 2 69220226 missense probably damaging 1.00
R1308:G6pc2 UTSW 2 69220226 missense probably damaging 1.00
R1417:G6pc2 UTSW 2 69222968 missense probably damaging 1.00
R1441:G6pc2 UTSW 2 69220854 missense probably damaging 0.97
R1658:G6pc2 UTSW 2 69227069 missense probably damaging 1.00
R1762:G6pc2 UTSW 2 69220842 missense possibly damaging 0.53
R1768:G6pc2 UTSW 2 69222977 missense probably damaging 1.00
R3161:G6pc2 UTSW 2 69220112 missense probably damaging 0.98
R5487:G6pc2 UTSW 2 69226577 missense probably damaging 0.99
R5686:G6pc2 UTSW 2 69220784 missense probably benign 0.03
R7493:G6pc2 UTSW 2 69223000 missense probably benign 0.00
R7733:G6pc2 UTSW 2 69220183 nonsense probably null
X0040:G6pc2 UTSW 2 69223010 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GATTTATCCTTCTTGGCCAGTG -3'
(R):5'- AAGGCGTGCTGTCAATGTGG -3'

Sequencing Primer
(F):5'- CCAGTGTAGGTAGTTGAAAGACTATG -3'
(R):5'- GCTGTCAATGTGGATCCAGTC -3'
Posted On2016-11-08