Incidental Mutation 'R5623:Skiv2l'
ID441709
Institutional Source Beutler Lab
Gene Symbol Skiv2l
Ensembl Gene ENSMUSG00000040356
Gene Namesuperkiller viralicidic activity 2-like (S. cerevisiae)
Synonyms4930534J06Rik, Ski2w
MMRRC Submission 043162-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5623 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34839228-34850210 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34847432 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 192 (K192E)
Ref Sequence ENSEMBL: ENSMUSP00000036265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046022] [ENSMUST00000097343] [ENSMUST00000165953] [ENSMUST00000172966] [ENSMUST00000173065] [ENSMUST00000173357] [ENSMUST00000173415]
Predicted Effect probably benign
Transcript: ENSMUST00000046022
AA Change: K192E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356
AA Change: K192E

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 171 176 N/A INTRINSIC
low complexity region 208 237 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
DEXDc 304 487 3.61e-28 SMART
low complexity region 583 592 N/A INTRINSIC
HELICc 619 705 8.63e-17 SMART
Pfam:rRNA_proc-arch 760 1044 9.7e-39 PFAM
DSHCT 1067 1243 7.67e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097343
SMART Domains Protein: ENSMUSP00000094956
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165953
SMART Domains Protein: ENSMUSP00000131195
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172878
Predicted Effect probably benign
Transcript: ENSMUST00000172966
Predicted Effect probably benign
Transcript: ENSMUST00000173065
SMART Domains Protein: ENSMUSP00000133934
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 228 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173305
Predicted Effect probably benign
Transcript: ENSMUST00000173357
SMART Domains Protein: ENSMUSP00000134272
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173403
Predicted Effect probably benign
Transcript: ENSMUST00000173415
SMART Domains Protein: ENSMUSP00000134209
Gene: ENSMUSG00000040356

DomainStartEndE-ValueType
PDB:4A4Z|A 10 81 8e-14 PDB
Blast:DEXDc 19 76 2e-29 BLAST
Blast:DEXDc 136 242 9e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184474
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,546,094 Q772P possibly damaging Het
B3gnt2 C G 11: 22,837,018 A57P probably damaging Het
BC067074 T C 13: 113,346,634 I1590T possibly damaging Het
Birc6 T G 17: 74,528,656 D63E probably damaging Het
Ccdc13 T C 9: 121,833,733 E72G probably damaging Het
Cfap221 C T 1: 119,954,168 A297T probably benign Het
Chd1 T A 17: 15,754,932 N1081K probably damaging Het
Chrm3 C A 13: 9,877,387 V538L possibly damaging Het
Clec16a T A 16: 10,611,121 N37K probably benign Het
Cnksr3 T A 10: 7,120,548 I229F probably damaging Het
Dchs1 T C 7: 105,772,769 E148G probably damaging Het
Diaph1 A T 18: 37,896,093 probably benign Het
Dis3l A G 9: 64,307,603 F895L possibly damaging Het
Dnah1 G T 14: 31,286,023 D2142E possibly damaging Het
Dst T C 1: 34,190,133 V1944A possibly damaging Het
Eif4a2 C T 16: 23,110,219 probably benign Het
Ephb6 T A 6: 41,616,481 M487K probably benign Het
Fgf18 T G 11: 33,134,272 T61P probably damaging Het
G6pc2 A G 2: 69,226,583 E191G probably damaging Het
Gm10717 C T 9: 3,026,318 S55L probably benign Het
Gm5414 A G 15: 101,625,811 F286S probably damaging Het
Gpcpd1 G T 2: 132,534,717 A553E probably damaging Het
Gpr153 A G 4: 152,281,941 D321G possibly damaging Het
Hecw2 T A 1: 53,832,623 Q1388L probably null Het
Ighv14-3 A C 12: 114,060,090 S36A probably damaging Het
Inpp5j C A 11: 3,494,766 G969V probably damaging Het
Kat5 G A 19: 5,607,562 R307W probably damaging Het
Klk1b21 A G 7: 44,105,565 S95G probably damaging Het
Mdm1 G A 10: 118,150,789 V171I possibly damaging Het
Nfu1 TCGC T 6: 87,016,206 probably benign Het
Olfr175-ps1 C T 16: 58,824,343 R122H probably benign Het
Olfr776 G A 10: 129,261,032 V24M probably benign Het
Phkb T A 8: 85,843,048 probably benign Het
Pkd1l3 A T 8: 109,623,719 T399S possibly damaging Het
Prr14l A T 5: 32,844,508 probably benign Het
Psg21 A C 7: 18,655,014 L51R probably damaging Het
Ptprg T A 14: 12,153,857 I526N probably damaging Het
Rab1a T C 11: 20,201,626 probably benign Het
Rims2 A T 15: 39,478,615 Q620L probably damaging Het
Rnf215 T G 11: 4,135,453 S58A probably benign Het
Scaper A C 9: 55,864,507 V375G probably benign Het
Sgk3 A T 1: 9,802,295 probably benign Het
Slc34a3 T A 2: 25,233,300 probably null Het
Sspn T A 6: 145,961,226 C52S probably damaging Het
Strip1 T C 3: 107,626,826 E164G possibly damaging Het
Sult5a1 A C 8: 123,157,442 S47A probably damaging Het
Svep1 T C 4: 58,091,964 D1557G possibly damaging Het
Tdrd6 T C 17: 43,629,333 I275V probably damaging Het
Thada C T 17: 84,191,983 V1929I probably benign Het
Tmem132b G A 5: 125,623,352 R318Q probably damaging Het
Tmem176b T G 6: 48,834,070 I259L probably benign Het
Tmppe C A 9: 114,405,896 P421Q possibly damaging Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Tpcn2 T A 7: 145,267,334 R328W possibly damaging Het
Trem1 C T 17: 48,237,055 T36I probably damaging Het
Trpm2 C A 10: 77,932,139 R842L probably damaging Het
Zfp319 A G 8: 95,325,571 probably benign Het
Other mutations in Skiv2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Skiv2l APN 17 34839548 missense probably damaging 1.00
IGL00338:Skiv2l APN 17 34846667 missense probably damaging 0.99
IGL01284:Skiv2l APN 17 34839688 unclassified probably benign
IGL01308:Skiv2l APN 17 34840634 missense probably benign 0.19
IGL01874:Skiv2l APN 17 34841209 missense probably benign
IGL02114:Skiv2l APN 17 34841116 missense probably damaging 0.97
IGL02208:Skiv2l APN 17 34841675 missense probably damaging 0.99
IGL02274:Skiv2l APN 17 34845863 missense probably damaging 1.00
IGL02729:Skiv2l APN 17 34839605 missense possibly damaging 0.63
IGL02839:Skiv2l APN 17 34847798 missense probably benign
R0325:Skiv2l UTSW 17 34844815 missense possibly damaging 0.50
R1102:Skiv2l UTSW 17 34840106 missense probably benign 0.28
R1294:Skiv2l UTSW 17 34841064 splice site probably null
R1513:Skiv2l UTSW 17 34847444 missense probably damaging 1.00
R1557:Skiv2l UTSW 17 34848422 missense probably damaging 1.00
R1747:Skiv2l UTSW 17 34847806 missense probably benign 0.02
R2401:Skiv2l UTSW 17 34840385 missense probably benign
R3162:Skiv2l UTSW 17 34847813 nonsense probably null
R3162:Skiv2l UTSW 17 34847813 nonsense probably null
R3695:Skiv2l UTSW 17 34847912 missense probably damaging 1.00
R3700:Skiv2l UTSW 17 34849903 missense probably benign
R4654:Skiv2l UTSW 17 34849946 missense probably damaging 1.00
R4736:Skiv2l UTSW 17 34848197 missense possibly damaging 0.91
R4835:Skiv2l UTSW 17 34842921 missense possibly damaging 0.66
R5014:Skiv2l UTSW 17 34847425 missense probably benign 0.00
R5181:Skiv2l UTSW 17 34844826 missense probably benign 0.44
R5223:Skiv2l UTSW 17 34845166 critical splice donor site probably null
R5417:Skiv2l UTSW 17 34846598 missense probably damaging 0.98
R5878:Skiv2l UTSW 17 34846117 missense possibly damaging 0.83
R5979:Skiv2l UTSW 17 34841463 missense probably benign 0.01
R6412:Skiv2l UTSW 17 34840300 missense possibly damaging 0.92
R6501:Skiv2l UTSW 17 34844436 missense possibly damaging 0.95
R6532:Skiv2l UTSW 17 34844743 missense probably damaging 1.00
R6730:Skiv2l UTSW 17 34845190 nonsense probably null
R6732:Skiv2l UTSW 17 34845190 nonsense probably null
R6741:Skiv2l UTSW 17 34845190 nonsense probably null
R6742:Skiv2l UTSW 17 34845190 nonsense probably null
R6769:Skiv2l UTSW 17 34845190 nonsense probably null
R6771:Skiv2l UTSW 17 34845190 nonsense probably null
R7022:Skiv2l UTSW 17 34845207 missense possibly damaging 0.88
R7096:Skiv2l UTSW 17 34841470 missense probably benign
R7178:Skiv2l UTSW 17 34839464 missense probably benign
R7315:Skiv2l UTSW 17 34841169 missense probably benign 0.00
R7584:Skiv2l UTSW 17 34841675 missense possibly damaging 0.69
R7677:Skiv2l UTSW 17 34848164 missense probably benign 0.03
R7796:Skiv2l UTSW 17 34844418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAAGAGGCTCCAGCAGAC -3'
(R):5'- CTTTTACAAGTCAGGGAAACAAGCC -3'

Sequencing Primer
(F):5'- TGGATGATCTGAGGACCA -3'
(R):5'- CGAAAAGGTGTCCTCTCTAGTAGC -3'
Posted On2016-11-08