Incidental Mutation 'R5623:Slc34a3'
ID 441668
Institutional Source Beutler Lab
Gene Symbol Slc34a3
Ensembl Gene ENSMUSG00000006469
Gene Name solute carrier family 34 (sodium phosphate), member 3
Synonyms Npt2c, NPTIIc
MMRRC Submission 043162-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.221) question?
Stock # R5623 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25118909-25124282 bp(-) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to A at 25123312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006638] [ENSMUST00000091318] [ENSMUST00000205192]
AlphaFold Q80SU6
Predicted Effect probably null
Transcript: ENSMUST00000006638
SMART Domains Protein: ENSMUSP00000006638
Gene: ENSMUSG00000006469

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 84 231 1.8e-25 PFAM
low complexity region 254 269 N/A INTRINSIC
Pfam:Na_Pi_cotrans 337 538 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091318
SMART Domains Protein: ENSMUSP00000088868
Gene: ENSMUSG00000089953

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091318
SMART Domains Protein: ENSMUSP00000145470
Gene: ENSMUSG00000089953

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155420
Predicted Effect probably benign
Transcript: ENSMUST00000205192
SMART Domains Protein: ENSMUSP00000145127
Gene: ENSMUSG00000089953

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of SLC34A transporter family of proteins, and is expressed primarily in the kidney. It is involved in transporting phosphate into cells via sodium cotransport in the renal brush border membrane, and contributes to the maintenance of inorganic phosphate concentration in the kidney. Mutations in this gene are associated with hereditary hypophosphatemic rickets with hypercalciuria. Alternatively spliced transcript variants varying in the 5' UTR have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypercalciuria, hypercalcemia and increased plasma 1,25(OH)2D3 levels but do not develop hypophosphatemia, renal calcification, rickets, or osteomalacia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,679,165 (GRCm39) Q772P possibly damaging Het
B3gnt2 C G 11: 22,787,018 (GRCm39) A57P probably damaging Het
Birc6 T G 17: 74,835,651 (GRCm39) D63E probably damaging Het
Ccdc13 T C 9: 121,662,799 (GRCm39) E72G probably damaging Het
Cfap221 C T 1: 119,881,898 (GRCm39) A297T probably benign Het
Chd1 T A 17: 15,975,194 (GRCm39) N1081K probably damaging Het
Chrm3 C A 13: 9,927,423 (GRCm39) V538L possibly damaging Het
Clec16a T A 16: 10,428,985 (GRCm39) N37K probably benign Het
Cnksr3 T A 10: 7,070,548 (GRCm39) I229F probably damaging Het
Cspg4b T C 13: 113,483,168 (GRCm39) I1590T possibly damaging Het
Dchs1 T C 7: 105,421,976 (GRCm39) E148G probably damaging Het
Diaph1 A T 18: 38,029,146 (GRCm39) probably benign Het
Dis3l A G 9: 64,214,885 (GRCm39) F895L possibly damaging Het
Dnah1 G T 14: 31,007,980 (GRCm39) D2142E possibly damaging Het
Dst T C 1: 34,229,214 (GRCm39) V1944A possibly damaging Het
Eif4a2 C T 16: 22,928,969 (GRCm39) probably benign Het
Ephb6 T A 6: 41,593,415 (GRCm39) M487K probably benign Het
Fgf18 T G 11: 33,084,272 (GRCm39) T61P probably damaging Het
G6pc2 A G 2: 69,056,927 (GRCm39) E191G probably damaging Het
Gm10717 C T 9: 3,026,318 (GRCm39) S55L probably benign Het
Gm5414 A G 15: 101,534,246 (GRCm39) F286S probably damaging Het
Gpcpd1 G T 2: 132,376,637 (GRCm39) A553E probably damaging Het
Gpr153 A G 4: 152,366,398 (GRCm39) D321G possibly damaging Het
Hecw2 T A 1: 53,871,782 (GRCm39) Q1388L probably null Het
Ighv14-3 A C 12: 114,023,710 (GRCm39) S36A probably damaging Het
Inpp5j C A 11: 3,444,766 (GRCm39) G969V probably damaging Het
Kat5 G A 19: 5,657,590 (GRCm39) R307W probably damaging Het
Klk1b21 A G 7: 43,754,989 (GRCm39) S95G probably damaging Het
Mdm1 G A 10: 117,986,694 (GRCm39) V171I possibly damaging Het
Nfu1 TCGC T 6: 86,993,188 (GRCm39) probably benign Het
Or5k8 C T 16: 58,644,706 (GRCm39) R122H probably benign Het
Or6c206 G A 10: 129,096,901 (GRCm39) V24M probably benign Het
Phkb T A 8: 86,569,677 (GRCm39) probably benign Het
Pkd1l3 A T 8: 110,350,351 (GRCm39) T399S possibly damaging Het
Prr14l A T 5: 33,001,852 (GRCm39) probably benign Het
Psg21 A C 7: 18,388,939 (GRCm39) L51R probably damaging Het
Ptprg T A 14: 12,153,857 (GRCm38) I526N probably damaging Het
Rab1a T C 11: 20,151,626 (GRCm39) probably benign Het
Rims2 A T 15: 39,342,011 (GRCm39) Q620L probably damaging Het
Rnf215 T G 11: 4,085,453 (GRCm39) S58A probably benign Het
Scaper A C 9: 55,771,791 (GRCm39) V375G probably benign Het
Sgk3 A T 1: 9,872,520 (GRCm39) probably benign Het
Skic2 T C 17: 35,066,408 (GRCm39) K192E probably benign Het
Sspn T A 6: 145,906,952 (GRCm39) C52S probably damaging Het
Strip1 T C 3: 107,534,142 (GRCm39) E164G possibly damaging Het
Sult5a1 A C 8: 123,884,181 (GRCm39) S47A probably damaging Het
Svep1 T C 4: 58,091,964 (GRCm39) D1557G possibly damaging Het
Tdrd6 T C 17: 43,940,224 (GRCm39) I275V probably damaging Het
Thada C T 17: 84,499,411 (GRCm39) V1929I probably benign Het
Tmem132b G A 5: 125,700,416 (GRCm39) R318Q probably damaging Het
Tmem176b T G 6: 48,811,004 (GRCm39) I259L probably benign Het
Tmppe C A 9: 114,234,964 (GRCm39) P421Q possibly damaging Het
Tmprss11e G A 5: 86,857,315 (GRCm39) Q333* probably null Het
Tpcn2 T A 7: 144,821,071 (GRCm39) R328W possibly damaging Het
Trem1 C T 17: 48,544,083 (GRCm39) T36I probably damaging Het
Trpm2 C A 10: 77,767,973 (GRCm39) R842L probably damaging Het
Zfp319 A G 8: 96,052,199 (GRCm39) probably benign Het
Other mutations in Slc34a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02422:Slc34a3 APN 2 25,122,275 (GRCm39) missense probably benign 0.01
IGL02885:Slc34a3 APN 2 25,121,069 (GRCm39) missense probably damaging 1.00
IGL03131:Slc34a3 APN 2 25,121,246 (GRCm39) missense probably benign
IGL03166:Slc34a3 APN 2 25,122,186 (GRCm39) missense probably damaging 0.99
IGL03278:Slc34a3 APN 2 25,122,059 (GRCm39) missense probably benign 0.01
PIT4544001:Slc34a3 UTSW 2 25,120,607 (GRCm39) missense probably benign 0.27
R0415:Slc34a3 UTSW 2 25,119,122 (GRCm39) missense probably benign
R0558:Slc34a3 UTSW 2 25,123,077 (GRCm39) unclassified probably benign
R0883:Slc34a3 UTSW 2 25,121,245 (GRCm39) missense probably benign
R2107:Slc34a3 UTSW 2 25,120,999 (GRCm39) missense probably damaging 0.99
R2329:Slc34a3 UTSW 2 25,119,422 (GRCm39) missense possibly damaging 0.95
R3108:Slc34a3 UTSW 2 25,119,257 (GRCm39) missense probably benign
R4637:Slc34a3 UTSW 2 25,119,473 (GRCm39) missense possibly damaging 0.92
R5008:Slc34a3 UTSW 2 25,120,854 (GRCm39) missense possibly damaging 0.62
R5341:Slc34a3 UTSW 2 25,120,671 (GRCm39) missense probably benign 0.00
R6602:Slc34a3 UTSW 2 25,119,221 (GRCm39) missense probably damaging 0.99
R7512:Slc34a3 UTSW 2 25,122,253 (GRCm39) splice site probably null
R7784:Slc34a3 UTSW 2 25,122,237 (GRCm39) missense probably damaging 1.00
R8072:Slc34a3 UTSW 2 25,119,289 (GRCm39) missense probably benign 0.01
R8730:Slc34a3 UTSW 2 25,122,057 (GRCm39) missense possibly damaging 0.80
R8762:Slc34a3 UTSW 2 25,121,003 (GRCm39) missense probably benign 0.03
R8880:Slc34a3 UTSW 2 25,119,267 (GRCm39) missense probably benign 0.03
Z1176:Slc34a3 UTSW 2 25,119,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTTTGTAGAATTCCCAAGGAG -3'
(R):5'- AGGGGCCTGACTTTAGTCTG -3'

Sequencing Primer
(F):5'- TTTGTAGAATTCCCAAGGAGAAGGAC -3'
(R):5'- GCCTGACTTTAGTCTGCTTGG -3'
Posted On 2016-11-08