Incidental Mutation 'R5688:Faf1'
ID443485
Institutional Source Beutler Lab
Gene Symbol Faf1
Ensembl Gene ENSMUSG00000010517
Gene NameFas-associated factor 1
SynonymsDffrx, Fam
MMRRC Submission 043321-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5688 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location109676588-109963960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109794813 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 234 (Q234K)
Ref Sequence ENSEMBL: ENSMUSP00000099785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102724]
Predicted Effect probably damaging
Transcript: ENSMUST00000102724
AA Change: Q234K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099785
Gene: ENSMUSG00000010517
AA Change: Q234K

DomainStartEndE-ValueType
Pfam:UBA_4 8 43 2.5e-10 PFAM
low complexity region 68 82 N/A INTRINSIC
internal_repeat_1 109 155 3.24e-5 PROSPERO
low complexity region 174 180 N/A INTRINSIC
internal_repeat_1 204 250 3.24e-5 PROSPERO
UAS 335 480 3.79e-69 SMART
coiled coil region 496 560 N/A INTRINSIC
UBX 565 647 2.32e-33 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of Fas ligand (TNFSF6) with the FAS antigen (TNFRSF6) mediates programmed cell death, also called apoptosis, in a number of organ systems. The protein encoded by this gene binds to FAS antigen and can initiate apoptosis or enhance apoptosis initiated through FAS antigen. Initiation of apoptosis by the protein encoded by this gene requires a ubiquitin-like domain but not the FAS-binding domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous fail to develop beyond 2-cell stage. Mice homozygous for a hypomorphic gene trap allele exhibit decreased susceptibility to dopaminergic neuron neurotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,253,991 T449S possibly damaging Het
4931406P16Rik T G 7: 34,284,709 D163A probably damaging Het
Acp7 G A 7: 28,616,495 A222V probably benign Het
Ahnak A G 19: 9,002,519 D389G probably benign Het
Aldh1l2 A T 10: 83,501,925 S559T possibly damaging Het
Alms1 T A 6: 85,599,895 N144K possibly damaging Het
Anp32b T A 4: 46,469,868 probably null Het
Atf7 C T 15: 102,551,509 R57H probably damaging Het
Atp10b A T 11: 43,201,173 H345L probably benign Het
Cacna2d1 A T 5: 16,358,952 I859F probably damaging Het
Calcr T A 6: 3,714,730 probably null Het
Cd248 A G 19: 5,069,935 T604A probably benign Het
Cemip C T 7: 83,961,641 V702M probably damaging Het
Cep295 G T 9: 15,331,986 Q469K probably damaging Het
Cntn5 A G 9: 9,748,422 W485R probably damaging Het
Cpe T C 8: 64,609,155 N289S possibly damaging Het
Cyp2j11 G A 4: 96,345,121 R113C probably damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb7 T G 8: 19,495,151 L15R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ednrb T C 14: 103,823,395 D198G probably damaging Het
Engase A C 11: 118,487,320 E312A possibly damaging Het
Evl G A 12: 108,673,353 probably null Het
Gm5460 C A 14: 34,045,795 N453K possibly damaging Het
Gm7356 T A 17: 14,000,607 I387F possibly damaging Het
Hagh T C 17: 24,850,594 M1T probably null Het
Hars A T 18: 36,772,316 V155E probably damaging Het
Hist1h1c A G 13: 23,739,165 K106R probably damaging Het
Lca5 C A 9: 83,398,566 D394Y probably benign Het
Lmtk3 T C 7: 45,791,410 L280P probably damaging Het
Lrit1 C T 14: 37,062,428 A571V possibly damaging Het
Map4k2 C A 19: 6,346,806 P584H probably damaging Het
Mgst1 T C 6: 138,141,800 probably benign Het
Neb C T 2: 52,196,327 V5245I probably damaging Het
Oas3 T C 5: 120,758,802 N918S probably benign Het
Olfr1155 T A 2: 87,943,208 Q140L probably benign Het
Olfr1204 C T 2: 88,852,679 T243I probably benign Het
Olfr145 A C 9: 37,898,063 I220L possibly damaging Het
Ovch2 A G 7: 107,793,994 L224P probably damaging Het
Patj A T 4: 98,520,810 K34* probably null Het
Pcf11 T A 7: 92,658,808 R717S possibly damaging Het
Plcb1 A T 2: 135,335,480 E577D probably benign Het
Plxnb2 T C 15: 89,158,696 K1497E probably damaging Het
Pyroxd1 C A 6: 142,353,540 L141I probably damaging Het
Rhobtb3 G T 13: 75,872,418 N588K probably benign Het
Rnasel G A 1: 153,753,706 probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shank1 A T 7: 44,354,487 I1868F possibly damaging Het
Skiv2l2 A T 13: 112,873,056 C936* probably null Het
Slc28a3 A T 13: 58,558,649 S593T probably damaging Het
Slc29a4 T C 5: 142,714,098 I168T possibly damaging Het
Slc35f5 C T 1: 125,591,038 P502L probably benign Het
Slco6d1 T C 1: 98,480,768 I463T probably damaging Het
Slk A G 19: 47,620,012 D468G probably benign Het
Spata31d1d G T 13: 59,726,508 P1071Q probably damaging Het
Tert G A 13: 73,639,156 V754I probably damaging Het
Thada T C 17: 84,451,727 T235A probably benign Het
Ttn T C 2: 76,734,128 D28555G probably damaging Het
Ttn T A 2: 76,879,984 probably null Het
Ubqln4 T C 3: 88,565,268 L464P probably damaging Het
Unc45b A T 11: 82,922,817 N350I possibly damaging Het
Vmn2r65 T C 7: 84,940,692 D672G probably benign Het
Zfp947 T A 17: 22,146,085 I203L probably benign Het
Zfp964 T A 8: 69,664,116 H454Q probably benign Het
Other mutations in Faf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Faf1 APN 4 109840381 missense probably benign 0.10
IGL00569:Faf1 APN 4 109961880 makesense probably null
IGL01398:Faf1 APN 4 109736596 missense probably damaging 0.99
IGL01640:Faf1 APN 4 109840403 missense probably damaging 1.00
IGL01739:Faf1 APN 4 109677081 splice site probably benign
IGL02265:Faf1 APN 4 109742904 missense probably benign 0.00
IGL02372:Faf1 APN 4 109935582 missense probably benign 0.17
IGL02999:Faf1 APN 4 109861893 missense probably benign 0.01
R0058:Faf1 UTSW 4 109736624 missense probably benign 0.00
R0058:Faf1 UTSW 4 109736624 missense probably benign 0.00
R0098:Faf1 UTSW 4 109935499 missense probably damaging 0.99
R0098:Faf1 UTSW 4 109935499 missense probably damaging 0.99
R0183:Faf1 UTSW 4 109935610 missense probably benign
R0463:Faf1 UTSW 4 109890941 missense probably benign 0.02
R0505:Faf1 UTSW 4 109840403 missense possibly damaging 0.91
R0755:Faf1 UTSW 4 109961839 missense probably benign 0.00
R1705:Faf1 UTSW 4 109677002 start gained probably benign
R2061:Faf1 UTSW 4 109710808 missense probably damaging 1.00
R2132:Faf1 UTSW 4 109710845 missense probably damaging 1.00
R2133:Faf1 UTSW 4 109710845 missense probably damaging 1.00
R2696:Faf1 UTSW 4 109841328 missense possibly damaging 0.92
R3937:Faf1 UTSW 4 109757692 splice site probably benign
R3939:Faf1 UTSW 4 109861879 missense probably damaging 1.00
R4602:Faf1 UTSW 4 109727428 missense probably benign
R4727:Faf1 UTSW 4 109840367 missense probably damaging 0.96
R4860:Faf1 UTSW 4 109742896 missense probably damaging 0.99
R4860:Faf1 UTSW 4 109742896 missense probably damaging 0.99
R4896:Faf1 UTSW 4 109842299 missense probably benign 0.02
R4913:Faf1 UTSW 4 109935549 missense possibly damaging 0.96
R5721:Faf1 UTSW 4 109935666 missense probably benign 0.34
R5905:Faf1 UTSW 4 109890929 missense probably benign 0.03
R6190:Faf1 UTSW 4 109861815 missense probably damaging 0.97
R6364:Faf1 UTSW 4 109961800 missense possibly damaging 0.46
R6454:Faf1 UTSW 4 109842334 missense probably benign 0.27
R6805:Faf1 UTSW 4 109861852 missense probably damaging 1.00
R7101:Faf1 UTSW 4 109925956 missense probably benign 0.12
R7381:Faf1 UTSW 4 109861937 missense probably damaging 0.99
R7392:Faf1 UTSW 4 109794843 missense probably benign 0.01
R7584:Faf1 UTSW 4 109925957 missense probably damaging 0.99
R7660:Faf1 UTSW 4 109861837 missense probably damaging 0.98
R7678:Faf1 UTSW 4 109829864 missense probably benign 0.00
R7715:Faf1 UTSW 4 109710814 missense probably damaging 0.99
R7721:Faf1 UTSW 4 109736597 missense probably damaging 1.00
Z1176:Faf1 UTSW 4 109840356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAAGTTTCTTAACTGACAAGTC -3'
(R):5'- TTAATATGCTTGGCTTACGGGC -3'

Sequencing Primer
(F):5'- ATGCTCAGTGCTTAAGGAGGTAC -3'
(R):5'- GCTTACGGGCATTTGTTCTATAAATG -3'
Posted On2016-11-09