Incidental Mutation 'R5748:Olfr395'
ID445880
Institutional Source Beutler Lab
Gene Symbol Olfr395
Ensembl Gene ENSMUSG00000062186
Gene Nameolfactory receptor 395
SynonymsGA_x6K02T2P1NL-4062605-4061667, MOR135-10
MMRRC Submission 043355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5748 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73903318-73909299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73906895 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 199 (I199T)
Ref Sequence ENSEMBL: ENSMUSP00000149064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072991] [ENSMUST00000215690]
Predicted Effect probably damaging
Transcript: ENSMUST00000072991
AA Change: I199T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072756
Gene: ENSMUSG00000062186
AA Change: I199T

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
Pfam:7tm_4 31 309 6.2e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.8e-8 PFAM
Pfam:7tm_1 41 290 3.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215690
AA Change: I199T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.2045 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Acy1 T A 9: 106,436,727 N78I probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dhx16 T C 17: 35,883,314 L439P probably damaging Het
Dlk1 T C 12: 109,459,972 V257A probably benign Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Eml5 T A 12: 98,825,555 Y1234F probably damaging Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Gtse1 T C 15: 85,867,577 Y324H probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Med13l G A 5: 118,593,445 R62H probably damaging Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Nup85 T A 11: 115,580,512 L110Q probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tcfl5 G A 2: 180,642,257 silent Het
Tmx3 T C 18: 90,537,101 V314A probably benign Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Ylpm1 T A 12: 85,060,251 probably null Het
Zfp273 T C 13: 67,825,331 Y160H probably damaging Het
Other mutations in Olfr395
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr395 APN 11 73907313 missense probably damaging 1.00
IGL01618:Olfr395 APN 11 73907477 missense probably damaging 1.00
IGL01995:Olfr395 APN 11 73907435 missense possibly damaging 0.52
IGL02494:Olfr395 APN 11 73906724 missense possibly damaging 0.55
IGL02995:Olfr395 APN 11 73907219 missense possibly damaging 0.90
IGL03256:Olfr395 APN 11 73906696 missense probably benign 0.07
R0018:Olfr395 UTSW 11 73906626 missense probably damaging 1.00
R0701:Olfr395 UTSW 11 73906829 missense probably damaging 1.00
R0839:Olfr395 UTSW 11 73907312 missense probably damaging 0.99
R1222:Olfr395 UTSW 11 73907414 missense probably damaging 1.00
R1737:Olfr395 UTSW 11 73907085 missense possibly damaging 0.69
R1819:Olfr395 UTSW 11 73906679 missense probably benign 0.02
R2994:Olfr395 UTSW 11 73906715 missense probably damaging 1.00
R3195:Olfr395 UTSW 11 73906658 missense possibly damaging 0.91
R4622:Olfr395 UTSW 11 73906911 missense possibly damaging 0.55
R4753:Olfr395 UTSW 11 73906851 missense probably damaging 1.00
R5137:Olfr395 UTSW 11 73906626 missense probably damaging 1.00
R5448:Olfr395 UTSW 11 73906611 missense probably damaging 1.00
R5604:Olfr395 UTSW 11 73907027 missense probably benign 0.02
R5899:Olfr395 UTSW 11 73906929 missense probably damaging 1.00
R6156:Olfr395 UTSW 11 73906621 nonsense probably null
R6388:Olfr395 UTSW 11 73907292 missense probably damaging 1.00
R6572:Olfr395 UTSW 11 73906803 missense possibly damaging 0.91
R7241:Olfr395 UTSW 11 73907232 missense probably benign 0.05
Z1177:Olfr395 UTSW 11 73906613 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCATGGCCATGGAAATCTC -3'
(R):5'- TCATGAGCACCAAATTTTGTGC -3'

Sequencing Primer
(F):5'- GGCCATGGAAATCTCATTCACAGTAG -3'
(R):5'- GAGCACCAAATTTTGTGCTTTAC -3'
Posted On2016-11-21