Incidental Mutation 'R5748:Med13l'
ID445861
Institutional Source Beutler Lab
Gene Symbol Med13l
Ensembl Gene ENSMUSG00000018076
Gene Namemediator complex subunit 13-like
Synonyms9030618F05Rik, Thrap2, 6330591G05Rik, 2210413I17Rik, Trap240L
MMRRC Submission 043355-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5748 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location118560679-118765438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118593445 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 62 (R62H)
Ref Sequence ENSEMBL: ENSMUSP00000144092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]
Predicted Effect probably damaging
Transcript: ENSMUST00000100816
AA Change: R62H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: R62H

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 2.5e-116 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2197 1e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201010
AA Change: R62H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: R62H

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 1e-112 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2206 1.7e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201696
Meta Mutation Damage Score 0.6425 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Acy1 T A 9: 106,436,727 N78I probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dhx16 T C 17: 35,883,314 L439P probably damaging Het
Dlk1 T C 12: 109,459,972 V257A probably benign Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Eml5 T A 12: 98,825,555 Y1234F probably damaging Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Gtse1 T C 15: 85,867,577 Y324H probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Nup85 T A 11: 115,580,512 L110Q probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr395 A G 11: 73,906,895 I199T probably damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tcfl5 G A 2: 180,642,257 silent Het
Tmx3 T C 18: 90,537,101 V314A probably benign Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Ylpm1 T A 12: 85,060,251 probably null Het
Zfp273 T C 13: 67,825,331 Y160H probably damaging Het
Other mutations in Med13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Med13l APN 5 118724071 missense probably damaging 0.99
IGL01012:Med13l APN 5 118734028 missense probably damaging 0.99
IGL01316:Med13l APN 5 118762781 missense probably damaging 1.00
IGL01529:Med13l APN 5 118742335 missense probably damaging 1.00
IGL01731:Med13l APN 5 118742407 missense probably benign 0.05
IGL01790:Med13l APN 5 118593522 missense probably damaging 1.00
IGL02394:Med13l APN 5 118748833 missense probably benign 0.37
IGL02432:Med13l APN 5 118738400 missense possibly damaging 0.90
IGL02698:Med13l APN 5 118762829 missense probably damaging 0.99
IGL02801:Med13l APN 5 118745113 missense probably damaging 1.00
IGL03242:Med13l APN 5 118747445 missense probably benign
IGL03270:Med13l APN 5 118731430 missense probably damaging 1.00
Basics UTSW 5 118759264 critical splice donor site probably null
Fundament UTSW 5 118721474 missense probably damaging 1.00
Root UTSW 5 118593445 missense probably damaging 1.00
P0035:Med13l UTSW 5 118742620 missense probably benign 0.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0136:Med13l UTSW 5 118724050 missense probably benign 0.15
R0158:Med13l UTSW 5 118742449 missense unknown
R0197:Med13l UTSW 5 118671002 splice site probably benign
R0370:Med13l UTSW 5 118741826 missense probably benign 0.14
R0492:Med13l UTSW 5 118738495 missense probably damaging 1.00
R0532:Med13l UTSW 5 118759123 missense possibly damaging 0.78
R0726:Med13l UTSW 5 118748684 missense probably damaging 0.99
R0738:Med13l UTSW 5 118751633 missense probably damaging 0.99
R0827:Med13l UTSW 5 118726247 splice site probably benign
R0883:Med13l UTSW 5 118671002 splice site probably benign
R0959:Med13l UTSW 5 118754285 missense possibly damaging 0.89
R1458:Med13l UTSW 5 118738459 missense probably benign 0.00
R1562:Med13l UTSW 5 118738519 missense probably damaging 1.00
R1577:Med13l UTSW 5 118721392 missense probably damaging 1.00
R1661:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1665:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1720:Med13l UTSW 5 118741995 missense probably damaging 1.00
R1929:Med13l UTSW 5 118728833 missense probably benign 0.01
R1967:Med13l UTSW 5 118761322 missense probably damaging 0.99
R2301:Med13l UTSW 5 118593447 missense probably damaging 1.00
R3691:Med13l UTSW 5 118721497 missense probably benign 0.16
R3895:Med13l UTSW 5 118761323 missense probably null 0.99
R4043:Med13l UTSW 5 118593463 missense probably damaging 1.00
R4593:Med13l UTSW 5 118742560 missense probably damaging 1.00
R4902:Med13l UTSW 5 118745130 missense probably damaging 1.00
R4995:Med13l UTSW 5 118730949 missense possibly damaging 0.90
R5010:Med13l UTSW 5 118593550 missense possibly damaging 0.95
R5057:Med13l UTSW 5 118718493 missense probably damaging 1.00
R5369:Med13l UTSW 5 118724010 missense probably benign 0.02
R5446:Med13l UTSW 5 118742397 missense possibly damaging 0.81
R5564:Med13l UTSW 5 118742040 missense probably damaging 1.00
R5566:Med13l UTSW 5 118728665 missense possibly damaging 0.95
R5580:Med13l UTSW 5 118751630 missense possibly damaging 0.95
R5634:Med13l UTSW 5 118560850 missense possibly damaging 0.88
R5764:Med13l UTSW 5 118728642 missense probably damaging 0.99
R5765:Med13l UTSW 5 118728642 missense probably damaging 0.99
R6083:Med13l UTSW 5 118721486 missense possibly damaging 0.80
R6504:Med13l UTSW 5 118754321 missense probably benign 0.34
R6546:Med13l UTSW 5 118721474 missense probably damaging 1.00
R6797:Med13l UTSW 5 118759264 critical splice donor site probably null
R6911:Med13l UTSW 5 118755658 missense possibly damaging 0.95
R6942:Med13l UTSW 5 118745006 splice site probably null
R7018:Med13l UTSW 5 118751986 missense probably damaging 0.99
R7096:Med13l UTSW 5 118721926 missense possibly damaging 0.90
R7113:Med13l UTSW 5 118726265 missense probably benign 0.09
R7136:Med13l UTSW 5 118721522 missense possibly damaging 0.90
R7140:Med13l UTSW 5 118741972 missense probably benign 0.27
R7345:Med13l UTSW 5 118742760 missense probably damaging 1.00
R7409:Med13l UTSW 5 118754321 missense probably benign 0.34
R7410:Med13l UTSW 5 118560832 missense possibly damaging 0.94
R7432:Med13l UTSW 5 118751938 missense probably damaging 0.99
R7486:Med13l UTSW 5 118728474 missense probably benign 0.17
R7509:Med13l UTSW 5 118748930 missense probably damaging 0.97
R7722:Med13l UTSW 5 118747407 missense probably benign 0.32
R7802:Med13l UTSW 5 118728590 missense probably benign 0.03
R8081:Med13l UTSW 5 118728268 missense probably damaging 1.00
R8260:Med13l UTSW 5 118748729 missense possibly damaging 0.95
R8266:Med13l UTSW 5 118742109 missense probably damaging 1.00
R8347:Med13l UTSW 5 118742597 missense probably benign
R8365:Med13l UTSW 5 118728644 missense possibly damaging 0.81
X0065:Med13l UTSW 5 118729883 missense probably damaging 1.00
Z1088:Med13l UTSW 5 118749641 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCTTTGAAGAGACCTTGTGG -3'
(R):5'- AACACACTGTCCACTGCCTG -3'

Sequencing Primer
(F):5'- GTGGTGTGAAGTTTAATACAAATGCC -3'
(R):5'- GGGATCTGTTTTAAGCAACTCC -3'
Posted On2016-11-21