Incidental Mutation 'R5767:Dennd2d'
ID446319
Institutional Source Beutler Lab
Gene Symbol Dennd2d
Ensembl Gene ENSMUSG00000027901
Gene NameDENN/MADD domain containing 2D
Synonyms2010308M01Rik
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location106482405-106503030 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 106487815 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029508] [ENSMUST00000149225] [ENSMUST00000183271]
Predicted Effect probably benign
Transcript: ENSMUST00000029508
SMART Domains Protein: ENSMUSP00000029508
Gene: ENSMUSG00000027901

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
uDENN 47 139 4.15e-27 SMART
DENN 146 330 8.1e-71 SMART
dDENN 368 435 3.38e-18 SMART
low complexity region 447 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139062
Predicted Effect probably benign
Transcript: ENSMUST00000149225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164330
SMART Domains Protein: ENSMUSP00000127168
Gene: ENSMUSG00000091575

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183271
SMART Domains Protein: ENSMUSP00000138462
Gene: ENSMUSG00000027901

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
uDENN 57 149 4.15e-27 SMART
DENN 156 340 8.1e-71 SMART
dDENN 378 445 3.38e-18 SMART
low complexity region 457 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193651
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Dennd2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Dennd2d APN 3 106500545 missense possibly damaging 0.45
IGL01397:Dennd2d APN 3 106487049 critical splice donor site probably null 0.00
IGL01410:Dennd2d APN 3 106491226 missense probably damaging 1.00
IGL02022:Dennd2d APN 3 106499904 missense probably benign 0.00
IGL02032:Dennd2d APN 3 106491227 missense probably damaging 1.00
IGL02309:Dennd2d APN 3 106494968 missense probably benign
R0140:Dennd2d UTSW 3 106492483 missense probably benign 0.08
R0648:Dennd2d UTSW 3 106500555 missense probably damaging 0.97
R1519:Dennd2d UTSW 3 106492559 missense probably damaging 1.00
R1539:Dennd2d UTSW 3 106486920 missense probably benign 0.00
R1652:Dennd2d UTSW 3 106487001 missense probably benign 0.00
R1674:Dennd2d UTSW 3 106492517 missense probably benign 0.17
R2179:Dennd2d UTSW 3 106492460 missense probably benign 0.00
R3731:Dennd2d UTSW 3 106499955 missense probably damaging 1.00
R4077:Dennd2d UTSW 3 106482623 unclassified probably benign
R4134:Dennd2d UTSW 3 106482661 missense probably benign 0.34
R4135:Dennd2d UTSW 3 106482661 missense probably benign 0.34
R5214:Dennd2d UTSW 3 106486321 critical splice donor site probably null
R6001:Dennd2d UTSW 3 106492460 missense probably benign 0.00
R6239:Dennd2d UTSW 3 106494877 missense probably damaging 1.00
R7312:Dennd2d UTSW 3 106491263 missense probably benign 0.38
R7593:Dennd2d UTSW 3 106499928 missense probably damaging 1.00
R8841:Dennd2d UTSW 3 106486264 missense probably benign
Z1088:Dennd2d UTSW 3 106499874 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGTGGTTTCTCTCTGATGCCAC -3'
(R):5'- TGATACCCTTTCCTGCAGGC -3'

Sequencing Primer
(F):5'- CTCTCAGGAGGTTGGTCCAG -3'
(R):5'- CCTGCAGGCTGAGTGGTTAC -3'
Posted On2016-11-21