Incidental Mutation 'R5789:Zdhhc16'
ID448242
Institutional Source Beutler Lab
Gene Symbol Zdhhc16
Ensembl Gene ENSMUSG00000025157
Gene Namezinc finger, DHHC domain containing 16
Synonyms1500015N03Rik, Abl-philin 2, APH2
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location41933480-41944104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41938133 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 98 (H98Q)
Ref Sequence ENSEMBL: ENSMUSP00000153513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026154] [ENSMUST00000075280] [ENSMUST00000112123] [ENSMUST00000167927] [ENSMUST00000171561] [ENSMUST00000223802] [ENSMUST00000224258] [ENSMUST00000224562] [ENSMUST00000225968] [ENSMUST00000224896]
Predicted Effect probably damaging
Transcript: ENSMUST00000026154
AA Change: H118Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026154
Gene: ENSMUSG00000025157
AA Change: H118Q

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 115 137 N/A INTRINSIC
Pfam:zf-DHHC 151 289 1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075280
SMART Domains Protein: ENSMUSP00000074756
Gene: ENSMUSG00000034321

DomainStartEndE-ValueType
Pfam:ECR1_N 8 44 3.8e-12 PFAM
S1 66 147 3.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112123
SMART Domains Protein: ENSMUSP00000107751
Gene: ENSMUSG00000034321

DomainStartEndE-ValueType
Pfam:ECR1_N 7 41 3.9e-14 PFAM
Pfam:EXOSC1 64 94 7.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167927
SMART Domains Protein: ENSMUSP00000132483
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171561
SMART Domains Protein: ENSMUSP00000130900
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 312 6.3e-90 PFAM
low complexity region 372 386 N/A INTRINSIC
Pfam:MMS19_C 528 963 3.9e-116 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223785
Predicted Effect probably benign
Transcript: ENSMUST00000223802
Predicted Effect probably benign
Transcript: ENSMUST00000224258
Predicted Effect probably benign
Transcript: ENSMUST00000224537
Predicted Effect probably damaging
Transcript: ENSMUST00000224562
AA Change: H118Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225968
AA Change: H98Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225433
Meta Mutation Damage Score 0.7106 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display prenatal and neonatal lethality with bradycardia, abnormal heart morphology and eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Zdhhc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Zdhhc16 APN 19 41939660 missense probably benign 0.29
IGL01290:Zdhhc16 APN 19 41938048 splice site probably null
IGL01368:Zdhhc16 APN 19 41941506 splice site probably null
IGL02191:Zdhhc16 APN 19 41937691 nonsense probably null
FR4342:Zdhhc16 UTSW 19 41942149 intron probably benign
FR4548:Zdhhc16 UTSW 19 41942168 frame shift probably null
PIT4458001:Zdhhc16 UTSW 19 41937770 missense possibly damaging 0.66
R1258:Zdhhc16 UTSW 19 41938044 missense possibly damaging 0.64
R1335:Zdhhc16 UTSW 19 41940634 splice site probably null
R1757:Zdhhc16 UTSW 19 41941955 missense probably damaging 1.00
R3833:Zdhhc16 UTSW 19 41938114 critical splice donor site probably null
R4381:Zdhhc16 UTSW 19 41940654 missense possibly damaging 0.63
R4615:Zdhhc16 UTSW 19 41943683 missense possibly damaging 0.74
R6177:Zdhhc16 UTSW 19 41937759 missense probably benign 0.06
R7252:Zdhhc16 UTSW 19 41941551 missense probably damaging 1.00
R8458:Zdhhc16 UTSW 19 41939654 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACACTGAGCTTTGGAGGC -3'
(R):5'- GATTTCTGCCTCCAAAGATCCC -3'

Sequencing Primer
(F):5'- TGGAGGCATCTTACAAAGCTCTG -3'
(R):5'- TTTCTGCCTCCAAAGATCCCAAATC -3'
Posted On2016-12-15