Incidental Mutation 'R5789:Skiv2l2'
ID448231
Institutional Source Beutler Lab
Gene Symbol Skiv2l2
Ensembl Gene ENSMUSG00000016018
Gene Namesuperkiller viralicidic activity 2-like 2 (S. cerevisiae)
Synonyms2610528A15Rik
MMRRC Submission 043383-MU
Accession Numbers

Ncbi RefSeq: NM_028151.2; MGI:1919448

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location112867418-112927398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112891285 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 680 (N680K)
Ref Sequence ENSEMBL: ENSMUSP00000022281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022281]
Predicted Effect probably benign
Transcript: ENSMUST00000022281
AA Change: N680K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000022281
Gene: ENSMUSG00000016018
AA Change: N680K

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
DEXDc 134 317 6.42e-34 SMART
HELICc 437 526 3.14e-19 SMART
Pfam:rRNA_proc-arch 580 839 1.7e-91 PFAM
DSHCT 863 1040 1.69e-96 SMART
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Skiv2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Skiv2l2 APN 13 112914489 missense probably damaging 1.00
IGL01772:Skiv2l2 APN 13 112891325 missense probably benign 0.10
IGL01843:Skiv2l2 APN 13 112918561 splice site probably benign
IGL01972:Skiv2l2 APN 13 112881061 missense probably damaging 1.00
IGL02451:Skiv2l2 APN 13 112891347 missense probably damaging 1.00
IGL02716:Skiv2l2 APN 13 112883146 missense probably benign 0.13
IGL03234:Skiv2l2 APN 13 112880975 splice site probably benign
K3955:Skiv2l2 UTSW 13 112910979 nonsense probably null
P0038:Skiv2l2 UTSW 13 112910979 nonsense probably null
R0067:Skiv2l2 UTSW 13 112886862 missense probably benign 0.34
R0067:Skiv2l2 UTSW 13 112886862 missense probably benign 0.34
R0086:Skiv2l2 UTSW 13 112927328 missense probably benign 0.00
R0687:Skiv2l2 UTSW 13 112914361 missense probably damaging 1.00
R1216:Skiv2l2 UTSW 13 112914342 splice site probably benign
R1218:Skiv2l2 UTSW 13 112917622 missense probably damaging 1.00
R1312:Skiv2l2 UTSW 13 112883251 nonsense probably null
R1827:Skiv2l2 UTSW 13 112913099 critical splice donor site probably null
R1852:Skiv2l2 UTSW 13 112872927 missense probably benign 0.00
R1889:Skiv2l2 UTSW 13 112887490 missense probably benign 0.00
R2205:Skiv2l2 UTSW 13 112898890 missense probably benign 0.06
R2256:Skiv2l2 UTSW 13 112876512 missense probably damaging 0.98
R2394:Skiv2l2 UTSW 13 112883168 missense probably benign 0.02
R3717:Skiv2l2 UTSW 13 112895595 missense probably damaging 1.00
R3779:Skiv2l2 UTSW 13 112903392 splice site probably benign
R4613:Skiv2l2 UTSW 13 112921739 nonsense probably null
R4939:Skiv2l2 UTSW 13 112909892 missense possibly damaging 0.91
R5452:Skiv2l2 UTSW 13 112913181 missense probably null 0.96
R5591:Skiv2l2 UTSW 13 112927356 start codon destroyed probably null 0.88
R5688:Skiv2l2 UTSW 13 112873056 nonsense probably null
R5761:Skiv2l2 UTSW 13 112917662 missense probably damaging 0.96
R5851:Skiv2l2 UTSW 13 112908952 missense probably damaging 1.00
R6038:Skiv2l2 UTSW 13 112891290 missense probably benign 0.00
R6038:Skiv2l2 UTSW 13 112891290 missense probably benign 0.00
R6348:Skiv2l2 UTSW 13 112910917 missense possibly damaging 0.88
R7276:Skiv2l2 UTSW 13 112914439 missense probably benign 0.00
R7397:Skiv2l2 UTSW 13 112921686 missense probably benign
R7792:Skiv2l2 UTSW 13 112872909 missense probably benign 0.02
R7863:Skiv2l2 UTSW 13 112908901 missense probably benign 0.00
R7948:Skiv2l2 UTSW 13 112921762 missense probably benign 0.02
R8035:Skiv2l2 UTSW 13 112898802 missense probably benign 0.09
R8124:Skiv2l2 UTSW 13 112927337 missense probably benign 0.01
R8152:Skiv2l2 UTSW 13 112872983 nonsense probably null
R8189:Skiv2l2 UTSW 13 112891981 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GGCACATGGCTGACTTATTTC -3'
(R):5'- GTTAATTCACTGCCTTGTGACC -3'

Sequencing Primer
(F):5'- GGCTGACTTATTTCAAAAACAGCC -3'
(R):5'- GTGACCCTTTAATCACGATAGGG -3'
Posted On2016-12-15