Incidental Mutation 'IGL03050:Vmn2r97'
ID453448
Institutional Source Beutler Lab
Gene Symbol Vmn2r97
Ensembl Gene ENSMUSG00000091491
Gene Namevomeronasal 2, receptor 97
SynonymsEG627367
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #IGL03050 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18914300-18958087 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18947638 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 718 (M718T)
Ref Sequence ENSEMBL: ENSMUSP00000129313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168710] [ENSMUST00000232219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168710
AA Change: M718T

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129313
Gene: ENSMUSG00000091491
AA Change: M718T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 82 442 2.9e-36 PFAM
Pfam:NCD3G 513 566 4.9e-21 PFAM
Pfam:7tm_3 599 834 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232219
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,726,381 V825E probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Ankrd2 G A 19: 42,040,094 R63H probably damaging Het
Bbs2 C A 8: 94,074,413 probably benign Het
Btbd7 G T 12: 102,812,806 D400E probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col17a1 C T 19: 47,648,098 probably null Het
Col3a1 A G 1: 45,328,925 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Dpp8 C G 9: 65,054,836 S386C probably benign Het
Dscaml1 A C 9: 45,742,999 D1443A probably damaging Het
Dsp T C 13: 38,188,445 probably benign Het
Elf2 C T 3: 51,257,617 R262Q probably benign Het
Fat3 G A 9: 15,996,600 S2702F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 T A 5: 72,122,154 S347R probably benign Het
Hivep1 T C 13: 42,156,128 S615P probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mirt1 A G 19: 53,445,279 noncoding transcript Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mug1 T A 6: 121,880,571 S1085T possibly damaging Het
Myo18a A T 11: 77,818,770 T190S probably benign Het
Myo5a G A 9: 75,146,909 probably null Het
Olfr1012 A G 2: 85,759,441 *312Q probably null Het
Olfr1434 G T 19: 12,283,512 V155L probably benign Het
Olfr24 A T 9: 18,755,454 Y60* probably null Het
Olfr355 A T 2: 36,927,808 M102K probably damaging Het
Olfr356 T A 2: 36,937,623 F168Y probably damaging Het
Rgma G A 7: 73,417,515 V173M probably damaging Het
Rgsl1 G A 1: 153,825,676 S379F possibly damaging Het
Sec16a T A 2: 26,415,747 D2215V probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thrap3 G A 4: 126,165,542 probably null Het
Ttyh2 T A 11: 114,708,854 L370Q probably damaging Het
Ugt8a T C 3: 125,875,490 R322G possibly damaging Het
Zhx2 T C 15: 57,822,833 F533L possibly damaging Het
Other mutations in Vmn2r97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r97 APN 17 18947659 missense probably benign 0.37
IGL00962:Vmn2r97 APN 17 18929228 missense probably damaging 1.00
IGL01704:Vmn2r97 APN 17 18947811 missense probably damaging 0.99
IGL01888:Vmn2r97 APN 17 18929024 nonsense probably null
IGL02429:Vmn2r97 APN 17 18930334 missense possibly damaging 0.94
IGL02742:Vmn2r97 APN 17 18929170 missense probably damaging 0.97
IGL02934:Vmn2r97 APN 17 18929685 missense probably benign 0.00
IGL02978:Vmn2r97 APN 17 18948036 missense probably benign 0.01
IGL03230:Vmn2r97 APN 17 18929406 missense probably benign 0.10
IGL03241:Vmn2r97 APN 17 18928176 missense probably benign 0.11
PIT4469001:Vmn2r97 UTSW 17 18929616 missense probably benign 0.00
R0482:Vmn2r97 UTSW 17 18947668 missense probably damaging 1.00
R0514:Vmn2r97 UTSW 17 18914472 missense probably benign 0.25
R0944:Vmn2r97 UTSW 17 18947403 missense probably benign 0.13
R1061:Vmn2r97 UTSW 17 18928178 nonsense probably null
R1546:Vmn2r97 UTSW 17 18947848 missense probably damaging 1.00
R1725:Vmn2r97 UTSW 17 18929135 missense probably benign 0.43
R1860:Vmn2r97 UTSW 17 18947386 missense probably benign 0.01
R1938:Vmn2r97 UTSW 17 18929331 missense probably benign 0.01
R1944:Vmn2r97 UTSW 17 18940238 missense probably benign 0.00
R2027:Vmn2r97 UTSW 17 18929682 missense unknown
R2106:Vmn2r97 UTSW 17 18947838 missense probably damaging 1.00
R2151:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2153:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2154:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2516:Vmn2r97 UTSW 17 18947552 missense probably benign
R3739:Vmn2r97 UTSW 17 18928151 missense probably damaging 1.00
R3744:Vmn2r97 UTSW 17 18929628 missense probably benign
R3885:Vmn2r97 UTSW 17 18928334 missense possibly damaging 0.90
R3899:Vmn2r97 UTSW 17 18947611 missense probably damaging 0.96
R4115:Vmn2r97 UTSW 17 18928070 missense probably benign 0.01
R4247:Vmn2r97 UTSW 17 18947280 missense possibly damaging 0.83
R4287:Vmn2r97 UTSW 17 18948075 intron probably benign
R4439:Vmn2r97 UTSW 17 18930354 missense probably benign 0.00
R4523:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R4783:Vmn2r97 UTSW 17 18929288 missense probably benign
R4948:Vmn2r97 UTSW 17 18947299 missense possibly damaging 0.95
R4981:Vmn2r97 UTSW 17 18940174 nonsense probably null
R5029:Vmn2r97 UTSW 17 18947911 missense probably damaging 1.00
R5200:Vmn2r97 UTSW 17 18928353 missense probably damaging 1.00
R5541:Vmn2r97 UTSW 17 18928355 nonsense probably null
R5637:Vmn2r97 UTSW 17 18947366 nonsense probably null
R5765:Vmn2r97 UTSW 17 18947180 nonsense probably null
R5885:Vmn2r97 UTSW 17 18947773 missense possibly damaging 0.50
R6272:Vmn2r97 UTSW 17 18947599 missense possibly damaging 0.70
R6553:Vmn2r97 UTSW 17 18930304 nonsense probably null
R6818:Vmn2r97 UTSW 17 18947931 missense possibly damaging 0.95
R6880:Vmn2r97 UTSW 17 18914508 missense probably benign 0.00
R7012:Vmn2r97 UTSW 17 18947494 missense probably damaging 0.99
R7023:Vmn2r97 UTSW 17 18914401 missense probably damaging 1.00
R7044:Vmn2r97 UTSW 17 18914367 missense probably benign 0.05
R7191:Vmn2r97 UTSW 17 18930286 missense probably damaging 1.00
R7503:Vmn2r97 UTSW 17 18928208 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCAGACCACATTTGCAG -3'
(R):5'- ATGGCTACCATGACCTTCCC -3'

Sequencing Primer
(F):5'- GCAGTTGCTTTCACTATGGC -3'
(R):5'- CCCTTTAGTGCTGTGGTAGAC -3'
Posted On2017-02-08