Incidental Mutation 'R5927:Crebzf'
ID459946
Institutional Source Beutler Lab
Gene Symbol Crebzf
Ensembl Gene ENSMUSG00000051451
Gene NameCREB/ATF bZIP transcription factor
Synonyms1110034C16Rik, Zf, LAZip, 6330417B10Rik, LAZipII
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location90442729-90447994 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) C to T at 90444323 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061767] [ENSMUST00000107206] [ENSMUST00000126041] [ENSMUST00000143408] [ENSMUST00000208379]
Predicted Effect probably benign
Transcript: ENSMUST00000061767
SMART Domains Protein: ENSMUSP00000050972
Gene: ENSMUSG00000051451

DomainStartEndE-ValueType
low complexity region 41 64 N/A INTRINSIC
BRLZ 126 185 2.13e-2 SMART
low complexity region 195 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107205
SMART Domains Protein: ENSMUSP00000102823
Gene: ENSMUSG00000051451

DomainStartEndE-ValueType
Blast:BRLZ 1 37 7e-17 BLAST
low complexity region 47 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107206
SMART Domains Protein: ENSMUSP00000102824
Gene: ENSMUSG00000051451

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 126 149 N/A INTRINSIC
BRLZ 211 270 2.13e-2 SMART
low complexity region 280 295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126041
Predicted Effect probably benign
Transcript: ENSMUST00000143408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146291
Predicted Effect probably benign
Transcript: ENSMUST00000207252
Predicted Effect probably benign
Transcript: ENSMUST00000208379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209102
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Crebzf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0752:Crebzf UTSW 7 90443271 unclassified probably benign
R4526:Crebzf UTSW 7 90443760 missense possibly damaging 0.80
R5305:Crebzf UTSW 7 90444134 utr 3 prime probably benign
R5353:Crebzf UTSW 7 90443414 missense probably damaging 1.00
R5896:Crebzf UTSW 7 90443271 unclassified probably benign
R8490:Crebzf UTSW 7 90443498 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTTAGTGGGACATCGTCAC -3'
(R):5'- AGCACAAGTCTGTTTCCAGG -3'

Sequencing Primer
(F):5'- TCACCGGACGCATTTCAGAG -3'
(R):5'- GTGGACAAGGCCCAAATTAAGATTCC -3'
Posted On2017-02-28