Incidental Mutation 'R5915:Trim17'
ID461272
Institutional Source Beutler Lab
Gene Symbol Trim17
Ensembl Gene ENSMUSG00000036964
Gene Nametripartite motif-containing 17
Synonymsterf, Rnf16
MMRRC Submission 044112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5915 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58954685-58973098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58968562 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 201 (R201W)
Ref Sequence ENSEMBL: ENSMUSP00000037248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047697] [ENSMUST00000075141]
Predicted Effect probably damaging
Transcript: ENSMUST00000047697
AA Change: R201W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037248
Gene: ENSMUSG00000036964
AA Change: R201W

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075141
AA Change: R201W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074639
Gene: ENSMUSG00000036964
AA Change: R201W

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
PRY 294 347 8.95e-16 SMART
SPRY 348 472 2.54e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131221
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,667,163 V940E probably damaging Het
Adgrg7 A T 16: 56,730,385 probably null Het
Alox12e T C 11: 70,318,224 I399V possibly damaging Het
Apoa5 C A 9: 46,269,309 Q42K probably damaging Het
Arfgap1 A G 2: 180,978,422 Y243C possibly damaging Het
Arhgap12 A G 18: 6,037,016 probably null Het
Arl16 G A 11: 120,466,605 probably benign Het
Atp8b5 A G 4: 43,370,577 D951G probably damaging Het
Babam2 T A 5: 31,785,611 L80Q probably damaging Het
Celsr1 C T 15: 86,030,349 R1141H probably damaging Het
Celsr1 C T 15: 85,937,975 V1714I probably benign Het
Cep295 A G 9: 15,341,479 L351P probably damaging Het
Dlc1 T A 8: 36,938,675 probably benign Het
Dpy30 G T 17: 74,315,911 D25E probably benign Het
Drosha T C 15: 12,935,066 W998R probably damaging Het
Fibp A G 19: 5,463,616 D220G possibly damaging Het
Grm3 C T 5: 9,511,927 C641Y probably damaging Het
Gulo A T 14: 66,008,121 V8D probably benign Het
Ifrd1 A T 12: 40,213,096 C164S possibly damaging Het
Jam2 G A 16: 84,809,407 S103N probably benign Het
Krtap17-1 T C 11: 99,993,618 T108A unknown Het
Man2a2 A G 7: 80,360,921 F774S probably benign Het
Map1b G A 13: 99,430,331 R1961W unknown Het
Mib2 A G 4: 155,656,051 probably benign Het
Mr1 A T 1: 155,136,788 F127I probably damaging Het
Mrgprb2 A G 7: 48,552,806 I57T probably benign Het
Ncan G T 8: 70,098,081 Y1154* probably null Het
Nfx1 T A 4: 40,977,285 S320T probably benign Het
Nlrp4f A G 13: 65,187,555 L740P probably damaging Het
Nprl2 T C 9: 107,545,078 probably benign Het
Olfr1350 A T 7: 6,570,173 I61F probably benign Het
Opn1sw A G 6: 29,379,755 probably null Het
Palld A G 8: 61,533,352 probably null Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Rnf145 T C 11: 44,542,722 probably null Het
Sbf2 A T 7: 110,378,096 C610* probably null Het
Sec24a C T 11: 51,756,137 A13T probably benign Het
Smim8 TCTCCTC TCTC 4: 34,769,010 probably benign Het
Sox8 A C 17: 25,567,469 L420R probably damaging Het
Sry C G Y: 2,662,612 Q349H unknown Het
Sspo A T 6: 48,491,484 H4382L possibly damaging Het
Sspo A G 6: 48,464,596 D1889G probably benign Het
Tmem65 T C 15: 58,790,188 I141V probably damaging Het
Tpr A T 1: 150,425,649 T1329S probably benign Het
Trim3 A G 7: 105,617,975 L399P possibly damaging Het
Trim7 A G 11: 48,845,650 D277G possibly damaging Het
Vstm2b A G 7: 40,902,683 N153S possibly damaging Het
Wnk2 G T 13: 49,078,085 Q786K probably damaging Het
Wnk4 A G 11: 101,263,894 *286W probably null Het
Xpot A T 10: 121,615,093 L134Q probably damaging Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zc3h7a G A 16: 11,164,602 Q20* probably null Het
Zfp599 C T 9: 22,249,834 C345Y probably damaging Het
Other mutations in Trim17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Trim17 APN 11 58970597 missense probably damaging 1.00
IGL02581:Trim17 APN 11 58971076 nonsense probably null
P0026:Trim17 UTSW 11 58971258 missense possibly damaging 0.83
R0518:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0521:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0765:Trim17 UTSW 11 58971369 missense possibly damaging 0.73
R1165:Trim17 UTSW 11 58971215 missense possibly damaging 0.92
R1441:Trim17 UTSW 11 58965192 missense probably damaging 1.00
R2164:Trim17 UTSW 11 58971411 missense probably damaging 1.00
R2320:Trim17 UTSW 11 58966798 missense probably benign
R3436:Trim17 UTSW 11 58965233 missense probably damaging 1.00
R4715:Trim17 UTSW 11 58968450 intron probably benign
R4832:Trim17 UTSW 11 58971444 missense probably damaging 0.97
R4928:Trim17 UTSW 11 58954301 unclassified probably benign
R4950:Trim17 UTSW 11 58970428 missense probably damaging 0.98
R5339:Trim17 UTSW 11 58954510 splice site probably null
R5909:Trim17 UTSW 11 58968680 missense probably damaging 1.00
R5947:Trim17 UTSW 11 58965543 missense probably damaging 1.00
R6732:Trim17 UTSW 11 58971025 critical splice acceptor site probably null
R7027:Trim17 UTSW 11 58968616 missense probably benign 0.08
R7143:Trim17 UTSW 11 58965184 nonsense probably null
R7168:Trim17 UTSW 11 58968578 missense probably benign
R7682:Trim17 UTSW 11 58966808 missense possibly damaging 0.82
R7707:Trim17 UTSW 11 58965284 nonsense probably null
R7972:Trim17 UTSW 11 58968568 missense probably benign 0.01
Z1177:Trim17 UTSW 11 58965389 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCCCAGAATTGCTGTGTG -3'
(R):5'- TGCACATCTTCAGGCCACAC -3'

Sequencing Primer
(F):5'- TGTGTGGCAACCCTGAAG -3'
(R):5'- ACGTGTTCAGGCCACAC -3'
Posted On2017-02-28