Incidental Mutation 'R0499:Far1'
ID47019
Institutional Source Beutler Lab
Gene Symbol Far1
Ensembl Gene ENSMUSG00000030759
Gene Namefatty acyl CoA reductase 1
SynonymsMlstd2, 3732409C05Rik, 2600011M19Rik, 2900034E22Rik
MMRRC Submission 038695-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.704) question?
Stock #R0499 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location113513834-113571511 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 113554296 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033018] [ENSMUST00000067929] [ENSMUST00000136158] [ENSMUST00000164745]
Predicted Effect probably benign
Transcript: ENSMUST00000033018
SMART Domains Protein: ENSMUSP00000033018
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Epimerase 13 177 1e-8 PFAM
Pfam:NAD_binding_4 15 285 3.2e-80 PFAM
Pfam:Sterile 356 448 3.1e-34 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067929
SMART Domains Protein: ENSMUSP00000064334
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Epimerase 13 177 1e-8 PFAM
Pfam:NAD_binding_4 15 285 3.2e-80 PFAM
Pfam:Sterile 356 448 5.4e-36 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123845
Predicted Effect probably benign
Transcript: ENSMUST00000136158
SMART Domains Protein: ENSMUSP00000122643
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 2.3e-7 PFAM
Pfam:Epimerase 13 174 1.3e-9 PFAM
Pfam:NAD_binding_4 15 207 7.6e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156875
Predicted Effect probably benign
Transcript: ENSMUST00000164745
SMART Domains Protein: ENSMUSP00000128695
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Epimerase 13 241 1.5e-10 PFAM
Pfam:NAD_binding_4 15 285 9.9e-78 PFAM
Pfam:Sterile 355 448 5.8e-26 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the reduction of fatty acids to fatty alcohols, a process that is required for the synthesis of monoesters and ether lipids. NADPH is required as a cofactor in this reaction, and 16-18 carbon saturated and unsaturated fatty acids are the preferred substrate. This is a peroxisomal membrane protein, and studies suggest that the N-terminus contains a large catalytic domain located on the outside of the peroxisome, while the C-terminus is exposed to the matrix of the peroxisome. Studies indicate that the regulation of this protein is dependent on plasmalogen levels. Mutations in this gene have been associated with individuals affected by severe intellectual disability, early-onset epilepsy, microcephaly, congenital cataracts, growth retardation, and spasticity (PMID: 25439727). A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adap2 A T 11: 80,176,079 R276S probably damaging Het
Agbl3 A T 6: 34,839,335 M727L probably benign Het
Ahnak T A 19: 9,000,264 probably benign Het
Ankmy1 G T 1: 92,886,226 D410E probably damaging Het
Ankra2 T C 13: 98,266,454 S70P probably damaging Het
Aox4 T C 1: 58,263,397 probably null Het
Arl13b G A 16: 62,801,733 T399I probably benign Het
Atad2 A T 15: 58,103,240 D652E possibly damaging Het
Atad2 T G 15: 58,120,949 M328L probably benign Het
BC052040 C T 2: 115,642,691 R101W probably damaging Het
Ccnb1 T C 13: 100,780,134 probably null Het
Ccr2 G C 9: 124,105,939 K85N possibly damaging Het
Ccr2 A T 9: 124,106,126 T148S possibly damaging Het
Cdc20b T C 13: 113,055,950 V59A probably benign Het
Cdkl3 T C 11: 52,032,416 S507P possibly damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1g A G 8: 93,333,689 F101L probably benign Het
Cntnap3 C T 13: 64,858,678 D107N probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col27a1 A G 4: 63,300,741 probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Cstf3 A G 2: 104,649,605 I272M possibly damaging Het
Cyp2d40 T C 15: 82,761,217 T150A probably benign Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dopey2 A T 16: 93,770,437 T1251S probably benign Het
Dtx2 G A 5: 136,029,103 G421R probably damaging Het
Dusp27 C A 1: 166,099,101 V981L probably benign Het
Epb41l3 T A 17: 69,247,659 D251E probably benign Het
Erg A C 16: 95,360,983 Y305* probably null Het
Exosc4 G A 15: 76,329,566 A197T probably benign Het
Fam227b T A 2: 126,100,909 I323L probably benign Het
Fmod A G 1: 134,041,196 I325V possibly damaging Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm17359 T A 3: 79,405,786 W56R probably damaging Het
Gm17660 C A 5: 104,074,881 G24* probably null Het
Gm4076 G T 13: 85,127,226 noncoding transcript Het
Gm5134 A T 10: 75,992,525 Y313F probably benign Het
H2-Q6 T A 17: 35,425,203 F54I probably damaging Het
Hcrtr2 C A 9: 76,254,672 L145F probably damaging Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Herc2 C A 7: 56,184,369 C3107* probably null Het
Herc4 T C 10: 63,264,032 V78A probably damaging Het
Hyal5 T C 6: 24,877,921 W339R probably damaging Het
Igfbp6 T A 15: 102,147,984 probably null Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Itgb4 C A 11: 115,979,695 R117S probably benign Het
Lcorl C G 5: 45,734,369 G214A probably benign Het
Lgals3bp T A 11: 118,398,193 probably null Het
Lyst T A 13: 13,616,713 L54I probably damaging Het
Mcm9 T C 10: 53,538,154 T1015A probably benign Het
Mef2d T A 3: 88,156,518 I84N probably damaging Het
Mmrn2 A G 14: 34,397,956 N261S probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Mstn T A 1: 53,063,984 Y160N probably damaging Het
Muc6 T C 7: 141,640,468 T1431A probably benign Het
Nek9 A T 12: 85,301,883 M959K probably benign Het
Odf3l2 T C 10: 79,640,265 D155G probably damaging Het
Olfr1311 A T 2: 112,021,432 C141S probably damaging Het
Olfr319 G A 11: 58,702,243 V181I probably benign Het
Olfr911-ps1 A T 9: 38,524,505 M258L probably benign Het
Otog G T 7: 46,273,832 G1044W probably damaging Het
Pcdh9 G A 14: 93,886,235 T833M probably damaging Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Plekhg1 T C 10: 3,937,971 V355A probably damaging Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Psd T C 19: 46,322,161 E483G probably damaging Het
Ptch2 T A 4: 117,111,143 L905* probably null Het
Rxfp2 T A 5: 150,066,415 N420K probably damaging Het
Sde2 T A 1: 180,862,427 D237E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shc3 C T 13: 51,480,228 probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slc23a2 A G 2: 132,072,017 L280P probably damaging Het
Smchd1 G T 17: 71,387,088 Q1221K probably benign Het
Spocd1 A G 4: 129,955,470 N694S possibly damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tmem131 A T 1: 36,841,673 V172D probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Usp17le T C 7: 104,768,501 N478S probably benign Het
Usp36 A G 11: 118,273,571 V205A probably damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Vwf A T 6: 125,638,114 H1176L probably benign Het
Zfyve28 C T 5: 34,232,206 D217N possibly damaging Het
Zranb3 A C 1: 127,955,080 probably null Het
Other mutations in Far1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Far1 APN 7 113540689 missense probably benign 0.07
IGL02597:Far1 APN 7 113551256 missense probably benign 0.31
IGL02937:Far1 APN 7 113540648 missense probably damaging 0.98
R2045:Far1 UTSW 7 113539271 critical splice acceptor site probably null
R2140:Far1 UTSW 7 113566460 missense possibly damaging 0.89
R2852:Far1 UTSW 7 113553737 missense possibly damaging 0.95
R2853:Far1 UTSW 7 113553737 missense possibly damaging 0.95
R4423:Far1 UTSW 7 113540598 missense probably damaging 1.00
R4426:Far1 UTSW 7 113550001 missense probably benign 0.08
R4801:Far1 UTSW 7 113539453 missense possibly damaging 0.77
R4802:Far1 UTSW 7 113539453 missense possibly damaging 0.77
R4898:Far1 UTSW 7 113568225 missense probably damaging 1.00
R5762:Far1 UTSW 7 113568189 missense probably damaging 0.98
R6151:Far1 UTSW 7 113561396 missense possibly damaging 0.60
R6165:Far1 UTSW 7 113554218 missense probably benign
R6278:Far1 UTSW 7 113568137 missense probably benign 0.00
R7269:Far1 UTSW 7 113561447 missense probably benign 0.00
R7356:Far1 UTSW 7 113568142 missense possibly damaging 0.94
R7853:Far1 UTSW 7 113554148 missense probably damaging 1.00
R7936:Far1 UTSW 7 113554148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTTTTGTGAATGAGAAGACTGTTG -3'
(R):5'- ACCCCTAGATTATTAAGGGAGAGAGGGA -3'

Sequencing Primer
(F):5'- GACTGTTGAAAAAGACATTGTCAG -3'
(R):5'- agaatcaatgacccaatatgatgag -3'
Posted On2013-06-12