Incidental Mutation 'R5968:Olfr1'
ID470703
Institutional Source Beutler Lab
Gene Symbol Olfr1
Ensembl Gene ENSMUSG00000069823
Gene Nameolfactory receptor 1
SynonymsI54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390
MMRRC Submission 043249-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5968 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73393010-73399614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73395192 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 277 (M277V)
Ref Sequence ENSEMBL: ENSMUSP00000113707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120303
AA Change: M277V

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823
AA Change: M277V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206193
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,310,151 T978A probably benign Het
Adcy9 A G 16: 4,298,742 L638P probably damaging Het
Adgrf2 A G 17: 42,715,172 probably null Het
Anxa6 T C 11: 54,994,341 I461V probably damaging Het
Arap1 T C 7: 101,394,738 L668P probably damaging Het
B020031M17Rik T C 13: 119,950,082 probably benign Het
Ccdc144b T C 3: 36,010,691 Q511R probably benign Het
Ces2e G T 8: 104,932,995 G498W probably damaging Het
Crb1 A G 1: 139,243,001 C823R probably damaging Het
Ehmt1 C T 2: 24,836,457 R772H probably damaging Het
Enpep A G 3: 129,280,938 L721S probably benign Het
Flii T G 11: 60,720,212 I464L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Ift172 T C 5: 31,261,484 E1162G probably damaging Het
Meioc A G 11: 102,675,831 S758G probably damaging Het
Ndst1 A C 18: 60,713,076 S54A probably benign Het
Ndufaf8 G T 11: 120,099,229 E56* probably null Het
Ndufb7 A G 8: 83,566,901 D28G probably benign Het
Olfr447 A G 6: 42,911,546 I8V probably benign Het
Prkg1 A T 19: 30,592,924 F443I probably damaging Het
Pspc1 C T 14: 56,764,236 R227H probably benign Het
Ptpn21 A G 12: 98,710,890 Y120H probably damaging Het
Runx1t1 A T 4: 13,841,890 probably null Het
Ryr3 T C 2: 112,647,049 D4449G probably benign Het
Sacs C A 14: 61,189,629 A159E probably damaging Het
Slc16a14 T C 1: 84,912,505 I360V possibly damaging Het
Thop1 A G 10: 81,075,559 D93G probably benign Het
Tmem92 A C 11: 94,778,738 M85R probably benign Het
Ttn T C 2: 76,857,673 probably benign Het
Zdhhc5 T C 2: 84,694,375 probably null Het
Zfp335 T C 2: 164,892,394 H1291R probably damaging Het
Zfp957 C T 14: 79,214,056 C101Y probably damaging Het
Other mutations in Olfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Olfr1 APN 11 73395191 missense probably damaging 0.98
IGL01938:Olfr1 APN 11 73395645 missense probably damaging 1.00
IGL02270:Olfr1 APN 11 73395365 missense probably benign
IGL03287:Olfr1 APN 11 73396019 start codon destroyed probably null 1.00
R0006:Olfr1 UTSW 11 73395488 missense probably damaging 0.99
R0907:Olfr1 UTSW 11 73395119 missense probably damaging 0.97
R1982:Olfr1 UTSW 11 73395092 missense probably benign 0.00
R3804:Olfr1 UTSW 11 73395950 missense probably benign 0.01
R4064:Olfr1 UTSW 11 73395522 missense probably benign 0.04
R4171:Olfr1 UTSW 11 73395539 missense probably damaging 1.00
R4724:Olfr1 UTSW 11 73395155 missense probably damaging 1.00
R4732:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R4733:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R5030:Olfr1 UTSW 11 73395654 frame shift probably null
R5097:Olfr1 UTSW 11 73395293 missense probably damaging 1.00
R5098:Olfr1 UTSW 11 73395654 frame shift probably null
R5101:Olfr1 UTSW 11 73395654 frame shift probably null
R5135:Olfr1 UTSW 11 73395654 frame shift probably null
R5137:Olfr1 UTSW 11 73395654 frame shift probably null
R5192:Olfr1 UTSW 11 73395654 frame shift probably null
R5193:Olfr1 UTSW 11 73395653 frame shift probably null
R5193:Olfr1 UTSW 11 73395654 frame shift probably null
R5197:Olfr1 UTSW 11 73395654 frame shift probably null
R5220:Olfr1 UTSW 11 73395654 frame shift probably null
R5221:Olfr1 UTSW 11 73395654 frame shift probably null
R5222:Olfr1 UTSW 11 73395654 frame shift probably null
R5258:Olfr1 UTSW 11 73395654 frame shift probably null
R5297:Olfr1 UTSW 11 73395654 frame shift probably null
R5396:Olfr1 UTSW 11 73395654 frame shift probably null
R5398:Olfr1 UTSW 11 73395654 frame shift probably null
R5399:Olfr1 UTSW 11 73395654 frame shift probably null
R5432:Olfr1 UTSW 11 73395654 frame shift probably null
R5433:Olfr1 UTSW 11 73395654 frame shift probably null
R5531:Olfr1 UTSW 11 73395177 missense probably benign 0.26
R5634:Olfr1 UTSW 11 73395654 frame shift probably null
R5714:Olfr1 UTSW 11 73395361 unclassified probably null
R5812:Olfr1 UTSW 11 73395654 frame shift probably null
R5813:Olfr1 UTSW 11 73395654 frame shift probably null
R5814:Olfr1 UTSW 11 73395654 frame shift probably null
R5815:Olfr1 UTSW 11 73395654 frame shift probably null
R5913:Olfr1 UTSW 11 73395654 frame shift probably null
R5955:Olfr1 UTSW 11 73395654 frame shift probably null
R5956:Olfr1 UTSW 11 73395654 frame shift probably null
R6029:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6176:Olfr1 UTSW 11 73395654 frame shift probably null
R6177:Olfr1 UTSW 11 73395654 frame shift probably null
R6178:Olfr1 UTSW 11 73395654 frame shift probably null
R6196:Olfr1 UTSW 11 73395473 missense probably benign 0.08
R6995:Olfr1 UTSW 11 73395584 missense probably benign
R7035:Olfr1 UTSW 11 73395718 missense probably benign 0.00
R7470:Olfr1 UTSW 11 73395888 missense probably damaging 1.00
R7530:Olfr1 UTSW 11 73388363 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGTAGGCAATTAGTATGGCTGG -3'
(R):5'- TGTGGCCAGCATCTTTCTTG -3'

Sequencing Primer
(F):5'- CAATTAGTATGGCTGGTGGGC -3'
(R):5'- GCACTCATTACCATGTCCTATGTAAG -3'
Posted On2017-03-31