Incidental Mutation 'R5101:Or1e16'
ID 392371
Institutional Source Beutler Lab
Gene Symbol Or1e16
Ensembl Gene ENSMUSG00000069823
Gene Name olfactory receptor family 1 subfamily E member 16
Synonyms GA_x6K02T2P1NL-3556334-3555390, MOR135-13, I54, Olfr1
MMRRC Submission 042852-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R5101 (G1)
Quality Score 217
Status Validated
Chromosome 11
Chromosomal Location 73285902-73290321 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) AGCGGTCGTAGGC to AGC at 73286480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
AlphaFold Q8VGI1
Predicted Effect probably null
Transcript: ENSMUST00000120303
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,423,406 (GRCm39) T10A possibly damaging Het
Adgrg3 T C 8: 95,763,563 (GRCm39) F288S probably benign Het
Ago2 A G 15: 72,991,339 (GRCm39) V533A probably damaging Het
Akap9 T G 5: 4,051,748 (GRCm39) V1505G probably damaging Het
Apob T C 12: 8,061,934 (GRCm39) I3439T probably benign Het
C1qtnf7 T A 5: 43,773,314 (GRCm39) Y204* probably null Het
Cdc42bpb T C 12: 111,265,549 (GRCm39) E1461G probably damaging Het
Cdh3 C T 8: 107,268,024 (GRCm39) A353V possibly damaging Het
Clec4d A G 6: 123,244,071 (GRCm39) Y60C probably damaging Het
Cmya5 T A 13: 93,228,111 (GRCm39) T2326S possibly damaging Het
Cnot1 G A 8: 96,486,815 (GRCm39) L631F possibly damaging Het
Cntnap5a C T 1: 116,370,026 (GRCm39) T881I probably benign Het
Col6a1 T A 10: 76,545,740 (GRCm39) T911S unknown Het
Ctsw A G 19: 5,515,703 (GRCm39) V287A probably benign Het
Cyp2c23 T C 19: 44,017,622 (GRCm39) E2G unknown Het
Cytip A T 2: 58,037,911 (GRCm39) I151N probably damaging Het
Dnah10 A G 5: 124,909,577 (GRCm39) T4399A possibly damaging Het
Dock3 A T 9: 106,846,980 (GRCm39) I883N probably damaging Het
Entpd3 A G 9: 120,395,608 (GRCm39) *530W probably null Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gp1ba G A 11: 70,532,225 (GRCm39) V664M probably benign Het
Gpd2 T A 2: 57,245,913 (GRCm39) I481N probably damaging Het
Gvin-ps5 T C 7: 105,929,096 (GRCm39) noncoding transcript Het
Ildr2 A G 1: 166,135,331 (GRCm39) D342G probably damaging Het
Krt87 A G 15: 101,385,391 (GRCm39) I327T probably benign Het
Lats1 T A 10: 7,588,348 (GRCm39) C988* probably null Het
Lpin2 G A 17: 71,550,965 (GRCm39) W708* probably null Het
Mast4 T C 13: 102,872,864 (GRCm39) D2168G probably benign Het
Myo6 G T 9: 80,177,321 (GRCm39) E606* probably null Het
Nek7 A G 1: 138,443,431 (GRCm39) V174A probably benign Het
Nid1 T A 13: 13,658,339 (GRCm39) C695S probably damaging Het
Nme8 A G 13: 19,875,017 (GRCm39) probably null Het
Nr2c2 T C 6: 92,131,497 (GRCm39) probably null Het
Or2ag18 A T 7: 106,405,420 (GRCm39) I83K possibly damaging Het
Or4x11 A G 2: 89,867,391 (GRCm39) M43V probably benign Het
Or51ab3 G A 7: 103,201,150 (GRCm39) E53K probably damaging Het
Or9g19 A G 2: 85,600,268 (GRCm39) N41S probably damaging Het
Pms2 A G 5: 143,865,006 (GRCm39) D696G probably damaging Het
Psapl1 T A 5: 36,361,494 (GRCm39) C29S probably damaging Het
Scn3a A T 2: 65,291,850 (GRCm39) V1632D probably damaging Het
Slc22a1 C T 17: 12,886,129 (GRCm39) G168D probably damaging Het
Smad4 A G 18: 73,808,931 (GRCm39) V112A probably benign Het
Smc4 T C 3: 68,935,845 (GRCm39) V796A probably benign Het
Smco4 A G 9: 15,455,968 (GRCm39) E18G unknown Het
Spata31e2 T C 1: 26,722,417 (GRCm39) E921G possibly damaging Het
Sugp2 A G 8: 70,713,139 (GRCm39) E1035G probably damaging Het
Syde2 T C 3: 145,721,393 (GRCm39) S820P probably damaging Het
Syn2 T C 6: 115,240,860 (GRCm39) L410P probably damaging Het
Tmem131l T C 3: 83,844,811 (GRCm39) N466S probably damaging Het
Uba1y T G Y: 821,447 (GRCm39) probably null Het
Unc79 T C 12: 103,078,769 (GRCm39) S1645P probably damaging Het
Vmn2r17 A T 5: 109,576,217 (GRCm39) S363C probably damaging Het
Vmn2r78 T C 7: 86,571,563 (GRCm39) Y458H probably damaging Het
Other mutations in Or1e16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Or1e16 APN 11 73,286,017 (GRCm39) missense probably damaging 0.98
IGL01938:Or1e16 APN 11 73,286,471 (GRCm39) missense probably damaging 1.00
IGL02270:Or1e16 APN 11 73,286,191 (GRCm39) missense probably benign
IGL03287:Or1e16 APN 11 73,286,845 (GRCm39) start codon destroyed probably null 1.00
R0006:Or1e16 UTSW 11 73,286,314 (GRCm39) missense probably damaging 0.99
R0907:Or1e16 UTSW 11 73,285,945 (GRCm39) missense probably damaging 0.97
R1982:Or1e16 UTSW 11 73,285,918 (GRCm39) missense probably benign 0.00
R3804:Or1e16 UTSW 11 73,286,776 (GRCm39) missense probably benign 0.01
R4064:Or1e16 UTSW 11 73,286,348 (GRCm39) missense probably benign 0.04
R4171:Or1e16 UTSW 11 73,286,365 (GRCm39) missense probably damaging 1.00
R4724:Or1e16 UTSW 11 73,285,981 (GRCm39) missense probably damaging 1.00
R4732:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R4733:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R5030:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5097:Or1e16 UTSW 11 73,286,119 (GRCm39) missense probably damaging 1.00
R5098:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5135:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5137:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5192:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,479 (GRCm39) frame shift probably null
R5197:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5220:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5221:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5222:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5258:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5297:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5396:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5398:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5399:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5432:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5433:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5531:Or1e16 UTSW 11 73,286,003 (GRCm39) missense probably benign 0.26
R5634:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5714:Or1e16 UTSW 11 73,286,187 (GRCm39) splice site probably null
R5812:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5813:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5814:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5815:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5913:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5955:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5956:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5968:Or1e16 UTSW 11 73,286,018 (GRCm39) missense possibly damaging 0.75
R6029:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6176:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6177:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6178:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6196:Or1e16 UTSW 11 73,286,299 (GRCm39) missense probably benign 0.08
R6995:Or1e16 UTSW 11 73,286,410 (GRCm39) missense probably benign
R7035:Or1e16 UTSW 11 73,286,544 (GRCm39) missense probably benign 0.00
R7470:Or1e16 UTSW 11 73,286,714 (GRCm39) missense probably damaging 1.00
R7530:Or1e16 UTSW 11 73,279,189 (GRCm39) missense possibly damaging 0.55
R8461:Or1e16 UTSW 11 73,285,982 (GRCm39) missense probably damaging 1.00
R9149:Or1e16 UTSW 11 73,286,853 (GRCm39) unclassified probably benign
R9279:Or1e16 UTSW 11 73,279,789 (GRCm39) missense probably benign 0.05
R9293:Or1e16 UTSW 11 73,285,955 (GRCm39) missense probably damaging 0.99
R9682:Or1e16 UTSW 11 73,286,025 (GRCm39) missense probably benign 0.03
R9752:Or1e16 UTSW 11 73,286,479 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATTAACACGGGTGTCAGAGCAG -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'
Posted On 2016-06-15