Incidental Mutation 'R6087:Adam7'
ID484622
Institutional Source Beutler Lab
Gene Symbol Adam7
Ensembl Gene ENSMUSG00000022056
Gene Namea disintegrin and metallopeptidase domain 7
SynonymsEAP1
MMRRC Submission 044244-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location68497336-68533741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68510757 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 548 (C548S)
Ref Sequence ENSEMBL: ENSMUSP00000022640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022640]
Predicted Effect probably damaging
Transcript: ENSMUST00000022640
AA Change: C548S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022640
Gene: ENSMUSG00000022056
AA Change: C548S

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 25 156 1.6e-28 PFAM
Pfam:Reprolysin_5 197 378 1.2e-12 PFAM
Pfam:Reprolysin_4 197 382 2.6e-12 PFAM
Pfam:Reprolysin 199 393 1.3e-70 PFAM
Pfam:Reprolysin_2 219 383 1.1e-9 PFAM
Pfam:Reprolysin_3 223 346 9.5e-14 PFAM
DISIN 410 485 8.79e-30 SMART
ACR 486 623 3.51e-58 SMART
transmembrane domain 667 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128069
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is specifically expressed in epididymis where the encoded protein is transferred to the sperm surface during epididymal transit. This gene is located adjacent to a related gene from the ADAM family of proteins on chromosome 14. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with decreased cell height in caput epididymis, spermatic granuloma, kinked sperm flagellum and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Cyp2d40 T C 15: 82,764,004 Y36C possibly damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fbxo8 T A 8: 56,569,318 Y122N probably damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Itga3 C T 11: 95,052,443 probably null Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lipo5 A T 19: 33,465,975 I147K unknown Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Mical2 C T 7: 112,318,485 Q350* probably null Het
Nras T C 3: 103,060,321 F78L probably damaging Het
Nudt9 A G 5: 104,050,813 I65V probably benign Het
Olfr1129 A G 2: 87,575,915 D277G probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekha1 T G 7: 130,900,571 S175A probably benign Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Rad51c A G 11: 87,380,879 Y318H probably benign Het
Ret G T 6: 118,176,291 T472K possibly damaging Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zc3h13 T A 14: 75,330,709 D1147E probably damaging Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Adam7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Adam7 APN 14 68521938 missense possibly damaging 0.68
IGL01418:Adam7 APN 14 68525206 missense probably benign
IGL01934:Adam7 APN 14 68532599 missense probably damaging 1.00
IGL02655:Adam7 APN 14 68516611 missense probably damaging 1.00
IGL02669:Adam7 APN 14 68507894 missense probably damaging 1.00
PIT4445001:Adam7 UTSW 14 68509748 missense possibly damaging 0.88
R0195:Adam7 UTSW 14 68527627 splice site probably benign
R0277:Adam7 UTSW 14 68510857 splice site probably null
R0362:Adam7 UTSW 14 68509656 splice site probably benign
R0440:Adam7 UTSW 14 68510856 splice site probably null
R0927:Adam7 UTSW 14 68516684 missense probably damaging 1.00
R1172:Adam7 UTSW 14 68514921 missense probably damaging 1.00
R1270:Adam7 UTSW 14 68527669 missense probably damaging 0.98
R1299:Adam7 UTSW 14 68526299 splice site probably benign
R1527:Adam7 UTSW 14 68501521 missense probably benign 0.04
R1543:Adam7 UTSW 14 68521922 splice site probably benign
R1731:Adam7 UTSW 14 68525356 missense probably damaging 1.00
R1732:Adam7 UTSW 14 68498450 missense probably benign 0.00
R1921:Adam7 UTSW 14 68512625 missense possibly damaging 0.55
R2062:Adam7 UTSW 14 68505161 missense probably benign 0.09
R2156:Adam7 UTSW 14 68511343 missense probably benign 0.02
R2353:Adam7 UTSW 14 68505088 missense probably benign 0.01
R2697:Adam7 UTSW 14 68514783 nonsense probably null
R4080:Adam7 UTSW 14 68520539 missense probably benign 0.05
R4775:Adam7 UTSW 14 68507912 missense probably benign 0.41
R5202:Adam7 UTSW 14 68507856 missense possibly damaging 0.92
R6006:Adam7 UTSW 14 68511396 missense probably damaging 1.00
R6376:Adam7 UTSW 14 68505097 missense possibly damaging 0.78
R6417:Adam7 UTSW 14 68504621 missense probably benign 0.37
R6672:Adam7 UTSW 14 68504702 critical splice acceptor site probably null
R6756:Adam7 UTSW 14 68525279 missense probably benign 0.00
R6777:Adam7 UTSW 14 68525335 missense probably damaging 1.00
R6913:Adam7 UTSW 14 68533651 missense probably benign 0.22
R7127:Adam7 UTSW 14 68514769 critical splice donor site probably null
R7209:Adam7 UTSW 14 68529819 missense probably damaging 1.00
R7399:Adam7 UTSW 14 68504466 intron probably null
R7675:Adam7 UTSW 14 68499853 missense probably benign 0.07
R7788:Adam7 UTSW 14 68512645 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GCCCTGGTTTGGTAGCATTC -3'
(R):5'- CGGAAAGCTTAGCTGTGTTAGG -3'

Sequencing Primer
(F):5'- GGTTTGGTAGCATTCTTCTCCCTTG -3'
(R):5'- AAGCTTAGCTGTGTTAGGAAATG -3'
Posted On2017-08-16