Incidental Mutation 'R6115:Alx1'
ID485090
Institutional Source Beutler Lab
Gene Symbol Alx1
Ensembl Gene ENSMUSG00000036602
Gene NameALX homeobox 1
SynonymsCart1
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6115 (G1)
Quality Score168.009
Status Validated
Chromosome10
Chromosomal Location102998707-103030215 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103028443 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 55 (P55L)
Ref Sequence ENSEMBL: ENSMUSP00000152017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040859] [ENSMUST00000167156] [ENSMUST00000217946] [ENSMUST00000218282] [ENSMUST00000218681] [ENSMUST00000219194]
Predicted Effect probably benign
Transcript: ENSMUST00000040859
AA Change: P55L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042512
Gene: ENSMUSG00000036602
AA Change: P55L

DomainStartEndE-ValueType
HOX 132 194 1.84e-25 SMART
Pfam:OAR 301 321 7.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167156
AA Change: P55L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129230
Gene: ENSMUSG00000036602
AA Change: P55L

DomainStartEndE-ValueType
HOX 132 194 1.84e-25 SMART
Pfam:OAR 302 320 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170026
Predicted Effect possibly damaging
Transcript: ENSMUST00000217946
AA Change: P55L

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000218282
AA Change: P55L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218508
Predicted Effect possibly damaging
Transcript: ENSMUST00000218681
AA Change: P55L

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000219194
AA Change: P55L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0698 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has yet to be determined in humans; however, in rodents, it is necessary for survival of the forebrain mesenchyme and may also be involved in development of the cervix. Mutations in the mouse gene lead to neural tube defects such as acrania and meroanencephaly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit perinatal lethality with acrania and meroanencephaly, but the neural tube closure defect can be ameliorated with prenatal folic acid treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Alx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02331:Alx1 APN 10 103022299 missense possibly damaging 0.93
IGL02508:Alx1 APN 10 103022193 missense probably damaging 0.99
IGL03079:Alx1 APN 10 103009348 missense probably damaging 1.00
R1345:Alx1 UTSW 10 103028492 missense possibly damaging 0.86
R1370:Alx1 UTSW 10 103028492 missense possibly damaging 0.86
R1846:Alx1 UTSW 10 103025304 missense possibly damaging 0.88
R1912:Alx1 UTSW 10 103025361 missense probably damaging 1.00
R4649:Alx1 UTSW 10 103009332 missense probably damaging 0.99
R4767:Alx1 UTSW 10 103025186 nonsense probably null
R5484:Alx1 UTSW 10 103025316 missense probably damaging 0.99
R5979:Alx1 UTSW 10 103022259 missense probably damaging 1.00
R6919:Alx1 UTSW 10 103025200 missense probably damaging 1.00
R7781:Alx1 UTSW 10 103009192 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCAATCTGGATTCCTCTTGC -3'
(R):5'- CCAGGATTATGGAGTTTCTGAGC -3'

Sequencing Primer
(F):5'- TACCTCACTTCGGGGAAGGATG -3'
(R):5'- TCTGAGCGAGAAGTTTGCCC -3'
Posted On2017-08-16