Incidental Mutation 'R6115:Tm9sf4'
ID485062
Institutional Source Beutler Lab
Gene Symbol Tm9sf4
Ensembl Gene ENSMUSG00000068040
Gene Nametransmembrane 9 superfamily protein member 4
Synonyms
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location153161303-153210466 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 153182489 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000086422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089027]
Predicted Effect probably null
Transcript: ENSMUST00000089027
SMART Domains Protein: ENSMUSP00000086422
Gene: ENSMUSG00000068040

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMP70 55 600 5.3e-203 PFAM
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147978
Meta Mutation Damage Score 0.9505 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Homozygous mutants exhibit abnormal hair follicles and sebaceous glands, vertebrae and rib abnormalities, and increased circulating cholesterol, calcium, albumin, and total protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Tm9sf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Tm9sf4 APN 2 153202355 missense probably damaging 1.00
IGL02218:Tm9sf4 APN 2 153204616 missense probably benign 0.00
IGL02354:Tm9sf4 APN 2 153187650 missense probably benign
IGL02361:Tm9sf4 APN 2 153187650 missense probably benign
IGL03047:Tm9sf4 UTSW 2 153161406 utr 5 prime probably benign
R0079:Tm9sf4 UTSW 2 153191145 missense probably damaging 1.00
R0147:Tm9sf4 UTSW 2 153195313 missense probably benign 0.01
R0650:Tm9sf4 UTSW 2 153187365 missense probably benign 0.00
R0729:Tm9sf4 UTSW 2 153191145 missense probably damaging 1.00
R0739:Tm9sf4 UTSW 2 153203814 missense probably damaging 1.00
R1695:Tm9sf4 UTSW 2 153190912 missense probably benign 0.00
R2321:Tm9sf4 UTSW 2 153204586 missense probably damaging 1.00
R3608:Tm9sf4 UTSW 2 153178977 missense probably benign
R4031:Tm9sf4 UTSW 2 153198344 splice site probably benign
R4668:Tm9sf4 UTSW 2 153187308 missense probably damaging 1.00
R4669:Tm9sf4 UTSW 2 153187308 missense probably damaging 1.00
R5318:Tm9sf4 UTSW 2 153187656 missense probably benign
R5580:Tm9sf4 UTSW 2 153182430 missense probably damaging 1.00
R5705:Tm9sf4 UTSW 2 153182458 missense probably benign 0.00
R5870:Tm9sf4 UTSW 2 153194281 missense probably damaging 1.00
R5996:Tm9sf4 UTSW 2 153195571 splice site probably null
R7448:Tm9sf4 UTSW 2 153194347 missense probably benign 0.04
R7740:Tm9sf4 UTSW 2 153208743 missense probably damaging 1.00
R7848:Tm9sf4 UTSW 2 153202355 missense probably damaging 1.00
R7931:Tm9sf4 UTSW 2 153202355 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTTGCAGCAGCCTTC -3'
(R):5'- TGAGCCAATAAGGTAACATGCAC -3'

Sequencing Primer
(F):5'- GCAGCAGCCTTCTTGTTTCTGG -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2017-08-16