Incidental Mutation 'R6115:Zbtb4'
ID485093
Institutional Source Beutler Lab
Gene Symbol Zbtb4
Ensembl Gene ENSMUSG00000018750
Gene Namezinc finger and BTB domain containing 4
Synonyms9230111I22Rik, 2310026P19Rik
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69765912-69784023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69776322 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 151 (I151T)
Ref Sequence ENSEMBL: ENSMUSP00000104278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108638] [ENSMUST00000108639] [ENSMUST00000108640] [ENSMUST00000108642] [ENSMUST00000132528] [ENSMUST00000153943] [ENSMUST00000156932]
Predicted Effect probably damaging
Transcript: ENSMUST00000108638
AA Change: I151T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104278
Gene: ENSMUSG00000018750
AA Change: I151T

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108639
AA Change: I151T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104279
Gene: ENSMUSG00000018750
AA Change: I151T

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108640
AA Change: I151T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104280
Gene: ENSMUSG00000018750
AA Change: I151T

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108642
AA Change: I151T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104282
Gene: ENSMUSG00000018750
AA Change: I151T

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132528
SMART Domains Protein: ENSMUSP00000121694
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
Pfam:BTB 20 56 6.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153943
SMART Domains Protein: ENSMUSP00000118027
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
Pfam:BTB 20 51 5.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156932
SMART Domains Protein: ENSMUSP00000115687
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
Pfam:BTB 20 51 6e-8 PFAM
low complexity region 68 85 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Meta Mutation Damage Score 0.3103 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Zbtb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Zbtb4 APN 11 69776731 nonsense probably null
IGL02178:Zbtb4 APN 11 69776429 nonsense probably null
R0092:Zbtb4 UTSW 11 69779351 missense probably benign
R0403:Zbtb4 UTSW 11 69777639 missense probably damaging 0.99
R1276:Zbtb4 UTSW 11 69776219 missense probably damaging 1.00
R1654:Zbtb4 UTSW 11 69779169 missense probably damaging 0.98
R1734:Zbtb4 UTSW 11 69776463 missense probably benign 0.13
R1762:Zbtb4 UTSW 11 69778917 missense probably benign 0.03
R2224:Zbtb4 UTSW 11 69776358 missense probably benign 0.43
R2930:Zbtb4 UTSW 11 69776516 nonsense probably null
R4670:Zbtb4 UTSW 11 69776529 missense probably damaging 0.97
R4998:Zbtb4 UTSW 11 69778671 missense probably benign 0.31
R5956:Zbtb4 UTSW 11 69778214 missense probably benign 0.29
R5988:Zbtb4 UTSW 11 69778964 missense probably damaging 1.00
R6237:Zbtb4 UTSW 11 69778243 missense possibly damaging 0.70
R6803:Zbtb4 UTSW 11 69778628 missense possibly damaging 0.92
R7395:Zbtb4 UTSW 11 69776111 missense possibly damaging 0.58
R7756:Zbtb4 UTSW 11 69778542 missense probably benign 0.27
R7758:Zbtb4 UTSW 11 69778542 missense probably benign 0.27
R7877:Zbtb4 UTSW 11 69776037 missense probably benign 0.39
R8215:Zbtb4 UTSW 11 69778772 missense probably benign 0.00
R8306:Zbtb4 UTSW 11 69777483 missense probably damaging 1.00
R8407:Zbtb4 UTSW 11 69778275 missense probably benign 0.00
R8690:Zbtb4 UTSW 11 69776792 missense probably damaging 1.00
R8785:Zbtb4 UTSW 11 69778163 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTTCAGAGAAGCCCTACTAGC -3'
(R):5'- TTTTCCACATCGAGGGCAAGG -3'

Sequencing Primer
(F):5'- AGTTACTGGCGGCTCAGC -3'
(R):5'- CAAGGAAAGGGCCGCCG -3'
Posted On2017-08-16