Incidental Mutation 'R6142:Zfp40'
ID488642
Institutional Source Beutler Lab
Gene Symbol Zfp40
Ensembl Gene ENSMUSG00000002617
Gene Namezinc finger protein 40
SynonymsNTfin12, Zfp-40
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location23173869-23193252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23176337 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 425 (E425D)
Ref Sequence ENSEMBL: ENSMUSP00000128758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037057] [ENSMUST00000140313] [ENSMUST00000172177]
Predicted Effect probably benign
Transcript: ENSMUST00000037057
AA Change: E425D

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039794
Gene: ENSMUSG00000002617
AA Change: E425D

DomainStartEndE-ValueType
KRAB 43 103 2.96e-17 SMART
ZnF_C2H2 225 247 1.47e-3 SMART
ZnF_C2H2 281 302 5.77e0 SMART
ZnF_C2H2 308 330 4.34e0 SMART
ZnF_C2H2 336 358 1.82e-3 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 391 413 2.75e-3 SMART
ZnF_C2H2 419 441 1.38e-3 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 497 1.47e-3 SMART
ZnF_C2H2 503 525 8.47e-4 SMART
ZnF_C2H2 531 553 2.57e-3 SMART
ZnF_C2H2 559 581 8.47e-4 SMART
ZnF_C2H2 587 609 4.54e-4 SMART
ZnF_C2H2 615 636 1.26e1 SMART
ZnF_C2H2 642 664 5.59e-4 SMART
ZnF_C2H2 670 692 3.21e-4 SMART
ZnF_C2H2 698 720 2.24e-3 SMART
ZnF_C2H2 726 748 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135840
Predicted Effect probably benign
Transcript: ENSMUST00000140313
AA Change: E357D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121359
Gene: ENSMUSG00000002617
AA Change: E357D

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-16 BLAST
ZnF_C2H2 157 179 1.47e-3 SMART
ZnF_C2H2 213 234 5.77e0 SMART
ZnF_C2H2 240 262 4.34e0 SMART
ZnF_C2H2 268 290 1.82e-3 SMART
ZnF_C2H2 295 317 4.24e-4 SMART
ZnF_C2H2 323 345 2.75e-3 SMART
ZnF_C2H2 351 373 1.38e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 1.47e-3 SMART
ZnF_C2H2 435 457 8.47e-4 SMART
ZnF_C2H2 463 485 2.57e-3 SMART
ZnF_C2H2 491 513 8.47e-4 SMART
ZnF_C2H2 519 541 4.54e-4 SMART
ZnF_C2H2 547 568 1.26e1 SMART
ZnF_C2H2 574 596 5.59e-4 SMART
ZnF_C2H2 602 624 3.21e-4 SMART
ZnF_C2H2 630 652 2.24e-3 SMART
ZnF_C2H2 658 680 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142999
Predicted Effect probably benign
Transcript: ENSMUST00000172177
AA Change: E425D

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128758
Gene: ENSMUSG00000002617
AA Change: E425D

DomainStartEndE-ValueType
KRAB 43 103 2.96e-17 SMART
ZnF_C2H2 225 247 1.47e-3 SMART
ZnF_C2H2 281 302 5.77e0 SMART
ZnF_C2H2 308 330 4.34e0 SMART
ZnF_C2H2 336 358 1.82e-3 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 391 413 2.75e-3 SMART
ZnF_C2H2 419 441 1.38e-3 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 497 1.47e-3 SMART
ZnF_C2H2 503 525 8.47e-4 SMART
ZnF_C2H2 531 553 2.57e-3 SMART
ZnF_C2H2 559 581 8.47e-4 SMART
ZnF_C2H2 587 609 4.54e-4 SMART
ZnF_C2H2 615 636 1.26e1 SMART
ZnF_C2H2 642 664 5.59e-4 SMART
ZnF_C2H2 670 692 3.21e-4 SMART
ZnF_C2H2 698 720 2.24e-3 SMART
ZnF_C2H2 726 748 1.2e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Zfp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Zfp40 APN 17 23175742 missense probably benign 0.18
IGL02664:Zfp40 APN 17 23176986 missense probably benign 0.14
IGL02729:Zfp40 APN 17 23178311 missense probably damaging 0.99
R1288:Zfp40 UTSW 17 23182162 missense probably benign 0.01
R1450:Zfp40 UTSW 17 23175258 missense probably benign 0.15
R1535:Zfp40 UTSW 17 23175869 missense probably damaging 1.00
R1655:Zfp40 UTSW 17 23177266 missense probably benign 0.01
R1797:Zfp40 UTSW 17 23175540 missense possibly damaging 0.93
R2254:Zfp40 UTSW 17 23178370 missense possibly damaging 0.92
R3764:Zfp40 UTSW 17 23177127 missense possibly damaging 0.49
R4356:Zfp40 UTSW 17 23177190 missense probably benign 0.15
R4402:Zfp40 UTSW 17 23176719 missense possibly damaging 0.49
R4781:Zfp40 UTSW 17 23175655 missense probably damaging 0.99
R4792:Zfp40 UTSW 17 23177034 missense possibly damaging 0.79
R6179:Zfp40 UTSW 17 23178380 missense possibly damaging 0.51
R6759:Zfp40 UTSW 17 23176536 missense possibly damaging 0.95
R7294:Zfp40 UTSW 17 23176437 missense possibly damaging 0.60
R7332:Zfp40 UTSW 17 23176181 nonsense probably null
R7386:Zfp40 UTSW 17 23177007 missense probably damaging 0.96
R7462:Zfp40 UTSW 17 23178388 missense possibly damaging 0.71
R7479:Zfp40 UTSW 17 23177318 missense probably benign 0.23
R7641:Zfp40 UTSW 17 23178283 missense possibly damaging 0.92
R7725:Zfp40 UTSW 17 23178277 missense probably benign 0.38
R7825:Zfp40 UTSW 17 23176327 missense probably benign 0.24
X0022:Zfp40 UTSW 17 23177154 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTTGTAAGGTTTCTCTCCTGTGT -3'
(R):5'- AGAGGCCTTATGAATGTAAGCA -3'

Sequencing Primer
(F):5'- TGATGCATTCTAAGATCCGAGCC -3'
(R):5'- CAGATGTAATGAATGTGGCAAATCCC -3'
Posted On2017-10-10