Incidental Mutation 'R6142:Hmgxb3'
ID488648
Institutional Source Beutler Lab
Gene Symbol Hmgxb3
Ensembl Gene ENSMUSG00000024622
Gene NameHMG box domain containing 3
Synonyms2510002C16Rik, A630042L21Rik
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location61131279-61177050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61136237 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 991 (E991G)
Ref Sequence ENSEMBL: ENSMUSP00000089498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091884] [ENSMUST00000115268]
Predicted Effect probably benign
Transcript: ENSMUST00000091884
AA Change: E991G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089498
Gene: ENSMUSG00000024622
AA Change: E991G

DomainStartEndE-ValueType
HMG 40 110 6.8e-15 SMART
low complexity region 182 194 N/A INTRINSIC
internal_repeat_1 307 336 1.98e-9 PROSPERO
internal_repeat_1 583 612 1.98e-9 PROSPERO
low complexity region 817 830 N/A INTRINSIC
low complexity region 966 977 N/A INTRINSIC
low complexity region 1239 1254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115268
SMART Domains Protein: ENSMUSP00000110923
Gene: ENSMUSG00000024621

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158500
Meta Mutation Damage Score 0.0891 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of the non-canonical high mobility group (HMG) genes. The encoded protein contains an HMG-box domain found in DNA binding proteins such as transcription factors and chromosomal proteins. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Hmgxb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Hmgxb3 APN 18 61157739 missense probably benign 0.00
IGL01325:Hmgxb3 APN 18 61134006 missense probably damaging 1.00
IGL01364:Hmgxb3 APN 18 61146434 missense probably damaging 0.96
IGL02160:Hmgxb3 APN 18 61171236 missense probably damaging 1.00
IGL02271:Hmgxb3 APN 18 61132213 missense probably damaging 1.00
IGL02755:Hmgxb3 APN 18 61172188 missense probably damaging 1.00
R0309:Hmgxb3 UTSW 18 61155128 splice site probably benign
R0828:Hmgxb3 UTSW 18 61171354 missense probably damaging 1.00
R1276:Hmgxb3 UTSW 18 61165504 missense probably benign 0.04
R1429:Hmgxb3 UTSW 18 61150433 missense probably damaging 0.98
R1491:Hmgxb3 UTSW 18 61133908 missense probably benign 0.04
R1675:Hmgxb3 UTSW 18 61135559 missense probably damaging 1.00
R1886:Hmgxb3 UTSW 18 61137401 critical splice donor site probably null
R1887:Hmgxb3 UTSW 18 61137401 critical splice donor site probably null
R2070:Hmgxb3 UTSW 18 61171359 missense probably damaging 1.00
R2084:Hmgxb3 UTSW 18 61155023 splice site probably benign
R2110:Hmgxb3 UTSW 18 61155386 missense possibly damaging 0.54
R2112:Hmgxb3 UTSW 18 61155386 missense possibly damaging 0.54
R2149:Hmgxb3 UTSW 18 61157674 missense probably benign 0.08
R2342:Hmgxb3 UTSW 18 61162991 missense possibly damaging 0.89
R2436:Hmgxb3 UTSW 18 61147494 missense probably benign
R2898:Hmgxb3 UTSW 18 61155296 missense probably benign 0.00
R2975:Hmgxb3 UTSW 18 61162966 nonsense probably null
R3110:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R3111:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R3112:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R4327:Hmgxb3 UTSW 18 61167539 missense probably benign 0.11
R4710:Hmgxb3 UTSW 18 61137475 missense probably damaging 1.00
R4750:Hmgxb3 UTSW 18 61167496 missense probably benign
R4876:Hmgxb3 UTSW 18 61146534 missense possibly damaging 0.94
R5177:Hmgxb3 UTSW 18 61172194 missense probably damaging 1.00
R5490:Hmgxb3 UTSW 18 61162977 missense probably damaging 0.99
R5601:Hmgxb3 UTSW 18 61137622 missense probably damaging 1.00
R5718:Hmgxb3 UTSW 18 61140837 missense probably benign 0.05
R6011:Hmgxb3 UTSW 18 61163024 missense probably damaging 0.97
R6034:Hmgxb3 UTSW 18 61132522 missense probably damaging 1.00
R6034:Hmgxb3 UTSW 18 61132522 missense probably damaging 1.00
R6092:Hmgxb3 UTSW 18 61137600 missense possibly damaging 0.56
R6419:Hmgxb3 UTSW 18 61152224 missense possibly damaging 0.71
R6675:Hmgxb3 UTSW 18 61137576 missense possibly damaging 0.86
R7130:Hmgxb3 UTSW 18 61132378 missense probably benign
R7431:Hmgxb3 UTSW 18 61147445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCCTAAAACCAGTCTGTGTG -3'
(R):5'- AGGAACTAGCCGTGGTGTTG -3'

Sequencing Primer
(F):5'- CCCTAAAACCAGTCTGTGTGTGAAG -3'
(R):5'- ACTAGCCGTGGTGTTGCTGTC -3'
Posted On2017-10-10