Mutagenetix > Incidental Mutations

Incidental Mutation 'R6147:Ephb6'

488942

Institutional Source

Beutler Lab

Gene Symbol

Ephb6

Ensembl Gene

ENSMUSG00000029869

Gene Name

Eph receptor B6

Synonyms

Cekl, Mep

MMRRC Submission

044294-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.700) question?

Stock #

R6147 (G1)

Quality Score

224.009

Status

Not validated

Chromosome

Chromosomal Location

41605482-41620509 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 41616781 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 533 (S533C)

Ref Sequence

ENSEMBL: ENSMUSP00000110380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]

Predicted Effect

probably benign
Transcript: ENSMUST00000031902

SMART Domains

Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868

Domain	Start	End	E-Value	Type
ANK	44	74	2.39e2	SMART
ANK	78	107	6.17e-1	SMART
ANK	116	145	3.06e-5	SMART
ANK	162	191	1.85e-4	SMART
Blast:ANK	195	223	3e-10	BLAST
ANK	238	267	2.47e2	SMART
Pfam:Ion_trans	327	589	9.8e-18	PFAM
low complexity region	680	695	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114732
AA Change: S533C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: S533C

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
EPH_lbd	34	227	2.18e-100	SMART
low complexity region	242	255	N/A	INTRINSIC
Pfam:GCC2_GCC3	299	341	1.9e-9	PFAM
FN3	365	462	3.59e-3	SMART
FN3	481	562	3.73e-10	SMART
Pfam:EphA2_TM	589	660	3.4e-16	PFAM
Pfam:Pkinase	663	908	1.4e-29	PFAM
Pfam:Pkinase_Tyr	663	908	1.1e-67	PFAM
SAM	938	1005	1e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167082

Predicted Effect

probably benign
Transcript: ENSMUST00000167497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170624

Predicted Effect

probably benign
Transcript: ENSMUST00000201471

SMART Domains

Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868

Domain	Start	End	E-Value	Type
ANK	44	74	2.39e2	SMART
ANK	78	107	6.17e-1	SMART
ANK	116	145	3.06e-5	SMART
ANK	162	191	1.85e-4	SMART
Blast:ANK	195	223	3e-10	BLAST
ANK	238	267	2.47e2	SMART
Pfam:Ion_trans	327	589	9.8e-18	PFAM
low complexity region	680	695	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.3%
10x: 97.1%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	A	G	12: 55,379,308	Y168C	probably damaging	Het
Acmsd	C	T	1: 127,729,420		probably benign	Het
Acsf3	T	A	8: 122,781,474	D236E	probably damaging	Het
Aqp1	G	T	6: 55,336,610	E40D	probably benign	Het
Arfgef2	A	G	2: 166,871,495	D1272G	probably damaging	Het
Arfip1	A	G	3: 84,529,178	V97A	probably benign	Het
Atp6v1b2	T	A	8: 69,102,482	Y165*	probably null	Het
BC051142	T	C	17: 34,418,923	S31P	possibly damaging	Het
Bclaf1	T	A	10: 20,323,425	D189E	possibly damaging	Het
Camsap2	G	A	1: 136,345,400	T13M	probably damaging	Het
Cntn5	T	A	9: 10,012,889	Y297F	probably damaging	Het
Cntnap5b	G	A	1: 100,050,781	C174Y	probably damaging	Het
Cntrl	A	C	2: 35,165,733	D1213A	possibly damaging	Het
Comtd1	C	A	14: 21,848,815	A20S	probably damaging	Het
Cspg4	A	T	9: 56,888,772	R1264W	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dlgap2	T	A	8: 14,727,294	C180S	probably benign	Het
Ednra	C	T	8: 77,667,322		probably benign	Het
Fndc1	A	T	17: 7,753,762		probably null	Het
Gif	G	A	19: 11,747,572		probably benign	Het
Gm11639	T	C	11: 104,967,740	V3875A	unknown	Het
Gm12185	A	G	11: 48,915,890	I158T	probably benign	Het
Gm14325	A	T	2: 177,832,807	C161S	probably damaging	Het
Gm17677	A	T	9: 35,742,110	Y70F	possibly damaging	Het
Gm17677	A	G	9: 35,742,232	T111A	possibly damaging	Het
Ighv9-1	T	A	12: 114,094,220	Q20L	probably damaging	Het
Khnyn	G	C	14: 55,887,603	S438T	probably damaging	Het
Krt9	T	C	11: 100,188,839	S576G	unknown	Het
Lrriq4	A	T	3: 30,659,079	N443I	probably damaging	Het
Luzp1	A	G	4: 136,541,063	Y199C	probably damaging	Het
Map2k3	T	A	11: 60,949,950	Y268*	probably null	Het
Men1	T	A	19: 6,337,242	D248E	probably damaging	Het
Mfsd4b2	A	T	10: 39,921,577	C261S	probably benign	Het
Mpeg1	T	G	19: 12,462,894	I572S	probably damaging	Het
Mrgprb2	A	G	7: 48,552,365	V204A	possibly damaging	Het
Mycbp2	A	T	14: 103,155,509	C805*	probably null	Het
Nphs2	A	T	1: 156,318,726	K91*	probably null	Het
Obox3	A	G	7: 15,626,001	S248P	probably damaging	Het
Olfr1054	A	T	2: 86,332,500	N285K	probably damaging	Het
Olfr109	T	C	17: 37,466,539	I111T	probably benign	Het
Olfr1152	C	T	2: 87,868,717	T242I	probably benign	Het
Otogl	G	A	10: 107,777,117		silent	Het
Pan3	T	C	5: 147,548,283		probably benign	Het
Pcdhb5	T	A	18: 37,320,726	L53Q	probably damaging	Het
Pcdhb9	G	T	18: 37,402,441	R496L	possibly damaging	Het
Peg10	C	T	6: 4,754,499		probably benign	Het
Plce1	A	G	19: 38,702,037	K722E	probably damaging	Het
Plch1	A	G	3: 63,722,881	S489P	probably damaging	Het
Plekhg3	T	C	12: 76,565,211	V362A	probably damaging	Het
Radil	G	A	5: 142,497,940	H264Y	probably benign	Het
Ranbp2	C	A	10: 58,479,428	T1990K	probably damaging	Het
Rnf207	T	C	4: 152,315,655	D192G	probably damaging	Het
Ryr1	A	T	7: 29,085,914	F1784Y	possibly damaging	Het
Set	T	A	2: 30,066,824	S2T	probably benign	Het
Slc26a2	T	A	18: 61,201,685	Y232F	probably damaging	Het
Sntb1	T	A	15: 55,648,010	M393L	probably benign	Het
Stx16	A	G	2: 174,090,687	T18A	probably damaging	Het
Stxbp5	A	T	10: 9,808,472	S585T	possibly damaging	Het
Sult2a7	T	C	7: 14,465,163	E313G	probably damaging	Het
Tbck	A	G	3: 132,694,446	K86R	probably benign	Het
Tom1	A	T	8: 75,054,692	Q255L	possibly damaging	Het
Trbv4	A	G	6: 41,059,703	Y54C	probably damaging	Het
Trim34a	A	T	7: 104,261,191	Q400L	probably damaging	Het
Trim42	G	T	9: 97,363,329	H473N	probably benign	Het
Tshr	T	A	12: 91,538,235	M649K	possibly damaging	Het
Vmn2r11	C	T	5: 109,054,834	V126M	probably benign	Het
Vps13b	T	A	15: 35,930,031	H3971Q	probably benign	Het
Wdr75	T	A	1: 45,819,538	N622K	probably benign	Het
Wdr93	A	T	7: 79,758,497	Q242L	probably benign	Het

Other mutations in Ephb6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Ephb6	APN	6	41615911	unclassified	probably benign
IGL01691:Ephb6	APN	6	41614515	missense	probably benign	0.26
IGL02052:Ephb6	APN	6	41613322	missense	probably benign
IGL02079:Ephb6	APN	6	41616014	missense	possibly damaging	0.57
IGL03089:Ephb6	APN	6	41614174	missense	probably damaging	1.00
P4748:Ephb6	UTSW	6	41617285	missense	probably damaging	0.96
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0974:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1610:Ephb6	UTSW	6	41614373	nonsense	probably null
R1658:Ephb6	UTSW	6	41614245	missense	probably damaging	1.00
R1687:Ephb6	UTSW	6	41617366	missense	probably benign	0.08
R1733:Ephb6	UTSW	6	41619720	missense	probably benign	0.10
R2191:Ephb6	UTSW	6	41616085	missense	possibly damaging	0.82
R2439:Ephb6	UTSW	6	41618735	missense	probably benign	0.31
R2915:Ephb6	UTSW	6	41614238	missense	probably damaging	1.00
R3020:Ephb6	UTSW	6	41614521	missense	probably damaging	1.00
R3499:Ephb6	UTSW	6	41616159	nonsense	probably null
R4606:Ephb6	UTSW	6	41616574	missense	probably benign	0.15
R4663:Ephb6	UTSW	6	41617865	missense	probably damaging	1.00
R4668:Ephb6	UTSW	6	41614602	missense	possibly damaging	0.91
R4762:Ephb6	UTSW	6	41618160	missense	probably damaging	0.99
R4767:Ephb6	UTSW	6	41614185	missense	possibly damaging	0.81
R4780:Ephb6	UTSW	6	41616139	missense	probably damaging	1.00
R4846:Ephb6	UTSW	6	41616809	missense	probably benign
R4851:Ephb6	UTSW	6	41618145	missense	probably benign	0.00
R5016:Ephb6	UTSW	6	41618107	missense	probably benign	0.01
R5122:Ephb6	UTSW	6	41613404	missense	probably benign	0.00
R5313:Ephb6	UTSW	6	41616793	missense	possibly damaging	0.68
R5615:Ephb6	UTSW	6	41619291	missense	probably benign
R5623:Ephb6	UTSW	6	41616481	missense	probably benign	0.20
R5686:Ephb6	UTSW	6	41619704	missense	possibly damaging	0.57
R5840:Ephb6	UTSW	6	41615573	missense	possibly damaging	0.94
R6645:Ephb6	UTSW	6	41617272	missense	probably benign	0.01
R6730:Ephb6	UTSW	6	41617374	nonsense	probably null
R7412:Ephb6	UTSW	6	41620239	missense	probably damaging	1.00
R7442:Ephb6	UTSW	6	41618047	splice site	probably null
R7759:Ephb6	UTSW	6	41614605	missense	probably benign	0.00
R7857:Ephb6	UTSW	6	41613397	missense	probably benign
R8425:Ephb6	UTSW	6	41618646	missense	probably damaging	0.98
X0027:Ephb6	UTSW	6	41620080	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTGCGCTACTATGACCAG -3'
(R):5'- ACAAGATCTGTGGCTTTGAGTG -3'

Sequencing Primer
(F):5'- GCTACTATGACCAGGTGGGC -3'
(R):5'- TGAGTGTCTCGGGACCCAAATG -3'

Posted On

2017-10-10