Incidental Mutation 'R6163:Nwd2'
ID489958
Institutional Source Beutler Lab
Gene Symbol Nwd2
Ensembl Gene ENSMUSG00000090061
Gene NameNACHT and WD repeat domain containing 2
Synonyms3110047P20Rik, B830017A01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R6163 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location63649102-63810546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63805788 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 905 (A905E)
Ref Sequence ENSEMBL: ENSMUSP00000124712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159584]
Predicted Effect probably benign
Transcript: ENSMUST00000159584
AA Change: A905E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124712
Gene: ENSMUSG00000090061
AA Change: A905E

DomainStartEndE-ValueType
Pfam:DUF4062 42 145 1.5e-8 PFAM
Blast:AAA 408 691 3e-29 BLAST
WD40 939 995 1.06e2 SMART
WD40 998 1037 8.96e-2 SMART
Blast:WD40 1091 1126 9e-19 BLAST
Blast:WD40 1129 1170 1e-17 BLAST
Blast:WD40 1220 1260 3e-16 BLAST
WD40 1263 1302 3.4e-2 SMART
WD40 1347 1385 2.65e1 SMART
WD40 1386 1425 1.58e2 SMART
Blast:WD40 1466 1507 3e-19 BLAST
Blast:WD40 1606 1644 4e-18 BLAST
Blast:KR 1686 1730 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162757
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,288 Q228* probably null Het
4922502D21Rik C T 6: 129,326,747 R85H probably benign Het
Asic5 A G 3: 82,006,526 N169S probably damaging Het
Atad2b T A 12: 4,954,593 L374H probably benign Het
BC080695 A G 4: 143,572,035 K183E probably damaging Het
Birc2 G A 9: 7,819,035 T544I probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Cc2d2b C T 19: 40,756,506 T23I probably benign Het
Ccdc137 G T 11: 120,460,101 R108L possibly damaging Het
Cenpe T C 3: 135,269,003 I2308T probably damaging Het
Cpt1b T C 15: 89,424,417 T103A probably benign Het
Cpvl C A 6: 53,873,518 V445F probably damaging Het
Cttnbp2 A G 6: 18,434,951 S303P possibly damaging Het
Cyp17a1 T A 19: 46,669,322 I264F possibly damaging Het
Cyp51 T A 5: 4,100,199 I175F probably damaging Het
Dennd4c C T 4: 86,805,591 P695S possibly damaging Het
Dlgap2 A T 8: 14,846,641 Q1039L probably damaging Het
Dnah14 T C 1: 181,666,361 L1694P probably benign Het
Dnah2 G A 11: 69,520,903 Q298* probably null Het
Dsg2 G T 18: 20,598,669 probably null Het
Esr2 A C 12: 76,121,869 V522G probably damaging Het
Fmo9 T A 1: 166,667,393 H262L probably benign Het
Glb1l T A 1: 75,201,407 M373L probably benign Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm37240 T A 3: 84,515,785 E213D probably damaging Het
Gmip T A 8: 69,817,372 V675E probably benign Het
Grb10 C A 11: 11,943,932 E330* probably null Het
Hist1h2ai A T 13: 21,716,689 N90Y probably damaging Het
Hivep2 A G 10: 14,129,992 K778R probably damaging Het
Ighv1-26 T C 12: 114,788,796 S4G probably benign Het
Igkv3-3 T A 6: 70,687,273 V33E possibly damaging Het
Itga2 C A 13: 114,866,190 G588V probably damaging Het
Itpr1 C T 6: 108,388,284 H58Y probably damaging Het
Jmjd1c T A 10: 67,248,048 D2365E possibly damaging Het
Limk1 T C 5: 134,657,955 Y518C probably damaging Het
March6 G C 15: 31,465,351 H802Q probably benign Het
Mark2 A G 19: 7,290,761 S26P probably benign Het
Mdn1 T A 4: 32,716,040 L2074Q probably damaging Het
Mrpl37 T C 4: 107,064,596 E174G possibly damaging Het
Mtcl1 T C 17: 66,379,331 H860R probably benign Het
Neurod1 A G 2: 79,454,161 F293L probably benign Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr1375 T A 11: 51,048,768 Y220* probably null Het
Olfr1445 A C 19: 12,884,108 T76P probably damaging Het
Olfr307 A T 7: 86,336,384 I4N possibly damaging Het
Olfr860 A G 9: 19,845,728 I297T probably benign Het
Otop1 C A 5: 38,287,890 probably null Het
Otp A G 13: 94,875,780 H4R probably damaging Het
P4htm A C 9: 108,581,951 Y261D probably damaging Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Plekhg1 A T 10: 3,964,369 R1419W probably damaging Het
Prkd3 C A 17: 78,966,355 D491Y possibly damaging Het
Prr11 A C 11: 87,103,628 L64R possibly damaging Het
Pygo1 G T 9: 72,944,698 A56S probably damaging Het
Rexo5 A G 7: 119,805,247 T189A probably damaging Het
Rnf213 A T 11: 119,458,428 H3784L possibly damaging Het
Rps6ka5 T G 12: 100,595,920 probably null Het
Slco2b1 T A 7: 99,688,899 I93F probably damaging Het
Slfn8 T C 11: 83,003,864 *408W probably null Het
Sptbn1 C A 11: 30,159,443 E51* probably null Het
Ssc5d T A 7: 4,927,254 H111Q probably damaging Het
Sult1c1 T C 17: 53,973,953 N41D probably benign Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Tdo2 T C 3: 81,975,403 E2G possibly damaging Het
Tff2 T C 17: 31,144,178 E24G probably benign Het
Tjp2 C A 19: 24,125,704 probably null Het
Tnfrsf1b A T 4: 145,219,907 D311E probably benign Het
Usp15 G T 10: 123,168,305 N181K probably damaging Het
Vmn1r175 T G 7: 23,809,166 E12A possibly damaging Het
Vmn1r47 T C 6: 90,022,791 S302P probably damaging Het
Vmn2r58 A G 7: 41,837,401 M690T probably benign Het
Wee1 T A 7: 110,135,651 H465Q probably damaging Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Nwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nwd2 APN 5 63805475 missense probably benign
IGL01111:Nwd2 APN 5 63807300 missense probably damaging 1.00
IGL01152:Nwd2 APN 5 63806529 missense possibly damaging 0.74
IGL01307:Nwd2 APN 5 63808283 missense possibly damaging 0.95
IGL01449:Nwd2 APN 5 63805594 missense probably damaging 1.00
IGL01624:Nwd2 APN 5 63806810 missense probably damaging 1.00
IGL01997:Nwd2 APN 5 63804595 missense probably damaging 0.99
IGL02007:Nwd2 APN 5 63804699 missense possibly damaging 0.87
IGL02143:Nwd2 APN 5 63791653 splice site probably null
IGL02184:Nwd2 APN 5 63805677 missense probably damaging 1.00
IGL02379:Nwd2 APN 5 63805301 missense probably damaging 1.00
IGL02489:Nwd2 APN 5 63805227 missense probably damaging 1.00
IGL02580:Nwd2 APN 5 63808169 missense probably damaging 0.99
IGL02682:Nwd2 APN 5 63804677 missense probably benign 0.03
IGL02682:Nwd2 APN 5 63804678 missense probably damaging 1.00
IGL02891:Nwd2 APN 5 63725227 missense possibly damaging 0.91
IGL03135:Nwd2 APN 5 63805995 missense probably damaging 1.00
IGL03149:Nwd2 APN 5 63805995 missense probably damaging 1.00
R0113:Nwd2 UTSW 5 63807898 missense probably damaging 1.00
R0172:Nwd2 UTSW 5 63806369 missense probably benign 0.44
R0196:Nwd2 UTSW 5 63806351 missense probably benign 0.37
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0309:Nwd2 UTSW 5 63807218 missense probably damaging 1.00
R0311:Nwd2 UTSW 5 63804998 missense probably damaging 0.99
R0335:Nwd2 UTSW 5 63804773 missense probably benign 0.00
R0384:Nwd2 UTSW 5 63805682 missense probably benign 0.11
R0496:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0497:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0498:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0505:Nwd2 UTSW 5 63805111 missense probably damaging 1.00
R0655:Nwd2 UTSW 5 63791585 missense possibly damaging 0.73
R0762:Nwd2 UTSW 5 63800414 missense probably benign 0.33
R0835:Nwd2 UTSW 5 63800130 missense probably damaging 0.99
R0926:Nwd2 UTSW 5 63807891 missense probably damaging 0.99
R0948:Nwd2 UTSW 5 63807312 missense probably damaging 1.00
R1015:Nwd2 UTSW 5 63806811 missense probably damaging 1.00
R1086:Nwd2 UTSW 5 63806574 missense probably damaging 1.00
R1186:Nwd2 UTSW 5 63650024 utr 5 prime probably benign
R1305:Nwd2 UTSW 5 63745197 missense probably damaging 0.97
R1542:Nwd2 UTSW 5 63806975 missense probably damaging 1.00
R1548:Nwd2 UTSW 5 63800182 missense probably benign 0.00
R1553:Nwd2 UTSW 5 63800505 missense probably benign 0.00
R1636:Nwd2 UTSW 5 63807557 missense probably damaging 1.00
R1658:Nwd2 UTSW 5 63807246 missense probably damaging 1.00
R1763:Nwd2 UTSW 5 63808271 missense probably benign
R1800:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R1813:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1861:Nwd2 UTSW 5 63804854 missense probably damaging 0.96
R1889:Nwd2 UTSW 5 63807666 missense possibly damaging 0.49
R1896:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1919:Nwd2 UTSW 5 63806180 missense probably damaging 1.00
R1922:Nwd2 UTSW 5 63794242 missense probably benign
R2258:Nwd2 UTSW 5 63805156 missense probably benign 0.00
R2292:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R2504:Nwd2 UTSW 5 63804374 missense probably benign 0.02
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2958:Nwd2 UTSW 5 63805982 missense probably benign 0.01
R3034:Nwd2 UTSW 5 63800103 missense probably damaging 1.00
R3422:Nwd2 UTSW 5 63725193 missense possibly damaging 0.46
R3423:Nwd2 UTSW 5 63800161 missense probably damaging 1.00
R3439:Nwd2 UTSW 5 63804552 missense probably benign 0.00
R4193:Nwd2 UTSW 5 63807465 missense probably damaging 1.00
R4254:Nwd2 UTSW 5 63806546 missense possibly damaging 0.74
R4384:Nwd2 UTSW 5 63806571 missense probably damaging 1.00
R4707:Nwd2 UTSW 5 63794322 missense probably damaging 1.00
R4713:Nwd2 UTSW 5 63804460 missense probably benign 0.00
R4735:Nwd2 UTSW 5 63808251 missense probably benign 0.34
R4744:Nwd2 UTSW 5 63806967 missense probably damaging 1.00
R4795:Nwd2 UTSW 5 63805433 missense probably benign 0.21
R4835:Nwd2 UTSW 5 63807846 missense probably benign 0.00
R4839:Nwd2 UTSW 5 63805550 missense possibly damaging 0.92
R4896:Nwd2 UTSW 5 63804808 missense probably damaging 1.00
R5017:Nwd2 UTSW 5 63650141 utr 5 prime probably benign
R5170:Nwd2 UTSW 5 63806037 missense probably damaging 0.99
R5312:Nwd2 UTSW 5 63806072 nonsense probably null
R5330:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5331:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5419:Nwd2 UTSW 5 63807708 missense probably benign 0.11
R5434:Nwd2 UTSW 5 63807648 missense probably benign 0.00
R5445:Nwd2 UTSW 5 63805338 missense probably damaging 1.00
R5761:Nwd2 UTSW 5 63725230 missense probably damaging 1.00
R5788:Nwd2 UTSW 5 63807771 missense probably benign 0.00
R5907:Nwd2 UTSW 5 63805983 missense probably damaging 0.99
R5959:Nwd2 UTSW 5 63808070 missense probably benign 0.32
R6002:Nwd2 UTSW 5 63804800 missense probably benign
R6027:Nwd2 UTSW 5 63808220 missense possibly damaging 0.65
R6082:Nwd2 UTSW 5 63805031 missense possibly damaging 0.96
R6172:Nwd2 UTSW 5 63806906 missense probably damaging 0.98
R6334:Nwd2 UTSW 5 63800253 missense possibly damaging 0.95
R6447:Nwd2 UTSW 5 63807555 missense probably benign 0.41
R6649:Nwd2 UTSW 5 63725184 missense possibly damaging 0.89
R6855:Nwd2 UTSW 5 63804451 missense probably benign 0.00
R7034:Nwd2 UTSW 5 63804915 missense probably damaging 1.00
R7168:Nwd2 UTSW 5 63807494 missense probably benign 0.04
R7326:Nwd2 UTSW 5 63800409 missense probably damaging 1.00
R7561:Nwd2 UTSW 5 63807091 nonsense probably null
R7576:Nwd2 UTSW 5 63807393 missense probably benign 0.00
R7580:Nwd2 UTSW 5 63808281 missense probably benign 0.05
R7723:Nwd2 UTSW 5 63808004 missense possibly damaging 0.69
R7769:Nwd2 UTSW 5 63804504 missense probably damaging 0.99
RF020:Nwd2 UTSW 5 63805723 nonsense probably null
X0023:Nwd2 UTSW 5 63806963 missense probably damaging 0.99
Z1176:Nwd2 UTSW 5 63725197 missense probably damaging 1.00
Z1176:Nwd2 UTSW 5 63806157 missense probably damaging 1.00
Z1177:Nwd2 UTSW 5 63804984 missense possibly damaging 0.60
Z1177:Nwd2 UTSW 5 63807326 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTGGGAAAACCGATGACCTC -3'
(R):5'- TTACAGGTGGGGAGGATCTC -3'

Sequencing Primer
(F):5'- GGAAAACCGATGACCTCCTTTATGG -3'
(R):5'- AGGATCTCTGTGACGTGCAG -3'
Posted On2017-10-10