Incidental Mutation 'R6225:Pds5b'
ID504258
Institutional Source Beutler Lab
Gene Symbol Pds5b
Ensembl Gene ENSMUSG00000034021
Gene NamePDS5 cohesin associated factor B
SynonymsAprin, AS3
MMRRC Submission 044356-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6225 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location150673739-150810690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 150746618 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 357 (V357G)
Ref Sequence ENSEMBL: ENSMUSP00000144572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016569] [ENSMUST00000038900] [ENSMUST00000202170]
Predicted Effect probably damaging
Transcript: ENSMUST00000016569
AA Change: V357G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016569
Gene: ENSMUSG00000034021
AA Change: V357G

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1247 1259 4.14e1 SMART
AT_hook 1285 1297 1.35e2 SMART
low complexity region 1307 1316 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
AT_hook 1370 1382 1.46e0 SMART
low complexity region 1437 1446 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000038900
AA Change: V357G

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038421
Gene: ENSMUSG00000034021
AA Change: V357G

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1249 1261 4.14e1 SMART
AT_hook 1287 1299 1.35e2 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
AT_hook 1373 1385 1.46e0 SMART
low complexity region 1440 1449 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133738
Predicted Effect probably damaging
Transcript: ENSMUST00000202170
AA Change: V357G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144572
Gene: ENSMUSG00000034021
AA Change: V357G

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1249 1261 4.14e1 SMART
AT_hook 1287 1299 1.35e2 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
AT_hook 1372 1384 1.46e0 SMART
low complexity region 1439 1448 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality with cardiac defects, craniofacial abnormalities, axial skeletal defects, shortening of most of the long bones, abnormal enteric nervous system morphology, and decreased germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,948,304 V1466A probably damaging Het
Ace A G 11: 105,979,619 H288R possibly damaging Het
Adh1 T C 3: 138,289,804 F323L probably benign Het
Adssl1 A C 12: 112,634,403 H226P probably damaging Het
Ahrr A G 13: 74,222,912 S230P possibly damaging Het
Akap9 T C 5: 3,962,105 V936A probably damaging Het
B4galnt2 A G 11: 95,868,442 Y339H probably damaging Het
C4b C A 17: 34,738,874 G611V possibly damaging Het
Cacna1i A G 15: 80,321,226 M128V probably damaging Het
Chia1 T C 3: 106,130,897 S370P possibly damaging Het
Cops6 T C 5: 138,161,411 V9A possibly damaging Het
D3Ertd254e T C 3: 36,166,203 F792L probably benign Het
D630003M21Rik A T 2: 158,217,401 I193K probably benign Het
Daam2 T C 17: 49,494,439 D90G probably damaging Het
Fads3 A G 19: 10,041,838 D36G probably benign Het
Fam185a T C 5: 21,425,556 V130A probably damaging Het
Fbn1 A T 2: 125,330,543 N1928K probably damaging Het
Fstl3 A G 10: 79,780,009 M110V probably benign Het
G2e3 A G 12: 51,369,136 T552A possibly damaging Het
Gfra1 G A 19: 58,238,398 T462I probably damaging Het
Glrx2 T A 1: 143,745,383 probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Gm43302 T A 5: 105,277,739 K275* probably null Het
Gm6569 A G 15: 73,839,791 probably benign Het
Herc6 G T 6: 57,662,154 V867L possibly damaging Het
Hhipl2 T A 1: 183,428,551 probably null Het
Kcnj16 A T 11: 111,025,552 K347* probably null Het
Kcnt2 T A 1: 140,426,923 C305* probably null Het
Large2 A G 2: 92,366,480 L477P probably damaging Het
Lnpep T C 17: 17,578,983 T137A possibly damaging Het
Mettl3 T C 14: 52,296,758 probably null Het
Mical3 C T 6: 120,958,723 S1614N probably damaging Het
Morc3 C A 16: 93,845,194 Y100* probably null Het
Mrc2 A G 11: 105,346,820 K1108R probably benign Het
Mrpl2 T C 17: 46,649,909 V243A probably damaging Het
Mtor T A 4: 148,521,337 N1505K probably benign Het
Mut T A 17: 40,938,731 V199E possibly damaging Het
Myo1g A T 11: 6,519,168 Y45N probably damaging Het
Nckap5l C A 15: 99,428,024 L199F possibly damaging Het
Ndufc2 A G 7: 97,406,892 T66A probably damaging Het
Nos1 T A 5: 117,912,852 H779Q probably damaging Het
Olfr1148 A G 2: 87,833,317 T93A probably benign Het
Olfr1264 A G 2: 90,021,229 probably null Het
Olfr180 T C 16: 58,916,182 N153S probably benign Het
Olfr221 C A 14: 52,035,368 V248L possibly damaging Het
Olfr382 T C 11: 73,517,005 N65D probably damaging Het
Olfr615 A T 7: 103,561,282 R268S probably benign Het
Olfr71 T C 4: 43,705,698 Y290C probably damaging Het
Otog C T 7: 46,249,034 T192I possibly damaging Het
Oxct1 T C 15: 4,035,330 V50A probably benign Het
P3h2 T A 16: 25,965,743 D667V probably damaging Het
Pcdhb20 A G 18: 37,504,994 Y191C probably damaging Het
Pggt1b A G 18: 46,274,607 V81A possibly damaging Het
Phxr2 A G 10: 99,126,181 probably benign Het
Pnpt1 T C 11: 29,145,469 I406T probably benign Het
Ppat T C 5: 76,922,355 I173V probably damaging Het
Proser3 T C 7: 30,543,728 S167G probably damaging Het
Rnf135 A C 11: 80,189,227 T115P possibly damaging Het
Rpl22 C T 4: 152,330,079 R65C probably benign Het
Scel T C 14: 103,591,984 F405L probably benign Het
Serinc3 A G 2: 163,627,879 Y350H probably damaging Het
Slc25a16 C A 10: 62,928,323 T53K probably damaging Het
Slco1a1 A T 6: 141,924,489 F308I possibly damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Smok3c T C 5: 138,065,052 V267A probably benign Het
Ssrp1 A G 2: 85,042,814 D473G probably benign Het
Svs6 A G 2: 164,317,485 E56G possibly damaging Het
Tas2r130 TCATTTC T 6: 131,630,584 probably benign Het
Thoc3 T C 13: 54,467,972 N93S probably benign Het
Tle6 A G 10: 81,592,766 C443R probably damaging Het
Tmed6 A G 8: 107,061,739 F192S probably damaging Het
Tpx2 A G 2: 152,876,628 N184D probably benign Het
Vmn2r31 T A 7: 7,394,639 N207Y probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp972 A T 2: 177,907,324 probably null Het
Zzef1 G A 11: 72,869,805 C1318Y possibly damaging Het
Other mutations in Pds5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Pds5b APN 5 150722542 missense probably benign 0.25
IGL01530:Pds5b APN 5 150792175 missense probably benign 0.38
IGL01812:Pds5b APN 5 150780689 missense probably damaging 1.00
IGL02163:Pds5b APN 5 150756406 missense probably benign 0.00
IGL02730:Pds5b APN 5 150780752 splice site probably benign
IGL02825:Pds5b APN 5 150728970 missense possibly damaging 0.90
IGL03143:Pds5b APN 5 150779257 missense probably damaging 1.00
IGL03379:Pds5b APN 5 150788331 missense probably damaging 1.00
PIT4283001:Pds5b UTSW 5 150778309 missense probably damaging 0.99
R0026:Pds5b UTSW 5 150749830 splice site probably benign
R0197:Pds5b UTSW 5 150754431 missense probably benign 0.28
R0347:Pds5b UTSW 5 150736427 splice site probably benign
R0396:Pds5b UTSW 5 150779275 missense possibly damaging 0.96
R0400:Pds5b UTSW 5 150723353 missense possibly damaging 0.46
R0442:Pds5b UTSW 5 150716544 splice site probably benign
R0745:Pds5b UTSW 5 150805671 missense probably benign
R0839:Pds5b UTSW 5 150764962 missense probably benign 0.23
R0866:Pds5b UTSW 5 150739191 splice site probably benign
R1247:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R1330:Pds5b UTSW 5 150761077 missense probably damaging 0.97
R1440:Pds5b UTSW 5 150754417 missense probably damaging 1.00
R1526:Pds5b UTSW 5 150716400 splice site probably null
R2010:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R2051:Pds5b UTSW 5 150748190 missense probably damaging 1.00
R2507:Pds5b UTSW 5 150756428 missense possibly damaging 0.90
R3111:Pds5b UTSW 5 150719907 missense probably damaging 1.00
R3820:Pds5b UTSW 5 150736337 missense possibly damaging 0.94
R3911:Pds5b UTSW 5 150746706 missense probably benign 0.41
R4077:Pds5b UTSW 5 150794359 missense possibly damaging 0.62
R4118:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R4342:Pds5b UTSW 5 150800854 missense probably benign 0.17
R4416:Pds5b UTSW 5 150736396 missense probably damaging 1.00
R4503:Pds5b UTSW 5 150728934 missense probably damaging 1.00
R4524:Pds5b UTSW 5 150788316 missense probably damaging 1.00
R4579:Pds5b UTSW 5 150746732 missense probably damaging 0.98
R4623:Pds5b UTSW 5 150800601 missense probably benign 0.37
R4847:Pds5b UTSW 5 150748112 missense probably damaging 1.00
R4885:Pds5b UTSW 5 150716462 missense probably benign 0.21
R5271:Pds5b UTSW 5 150723353 missense possibly damaging 0.46
R5281:Pds5b UTSW 5 150746608 missense probably benign 0.26
R5337:Pds5b UTSW 5 150793597 missense probably benign 0.03
R5635:Pds5b UTSW 5 150778221 missense possibly damaging 0.78
R5677:Pds5b UTSW 5 150716461 missense possibly damaging 0.91
R6005:Pds5b UTSW 5 150769776 splice site probably null
R6139:Pds5b UTSW 5 150800777 missense possibly damaging 0.81
R6279:Pds5b UTSW 5 150723248 missense possibly damaging 0.80
R6300:Pds5b UTSW 5 150723248 missense possibly damaging 0.80
R6666:Pds5b UTSW 5 150778166 missense probably damaging 1.00
R6805:Pds5b UTSW 5 150805561 splice site probably null
R7038:Pds5b UTSW 5 150800760 missense probably benign 0.02
R7046:Pds5b UTSW 5 150749920 missense probably damaging 1.00
R7051:Pds5b UTSW 5 150794282 missense possibly damaging 0.78
R7138:Pds5b UTSW 5 150800677 nonsense probably null
R7255:Pds5b UTSW 5 150796667 missense probably benign 0.33
R7467:Pds5b UTSW 5 150736327 missense probably damaging 0.99
R7488:Pds5b UTSW 5 150723337 missense probably damaging 0.97
R7512:Pds5b UTSW 5 150788342 missense probably damaging 1.00
R7561:Pds5b UTSW 5 150739318 critical splice donor site probably null
R7576:Pds5b UTSW 5 150778261 missense probably damaging 1.00
R7889:Pds5b UTSW 5 150792172 missense probably damaging 1.00
R7972:Pds5b UTSW 5 150792172 missense probably damaging 1.00
R8059:Pds5b UTSW 5 150807835 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGTGAGGGAAGGGGTAGCC -3'
(R):5'- CAAAGTATCCAGGGCATAGCT -3'

Sequencing Primer
(F):5'- GTAGTCCTGACTGTCCTGGAAC -3'
(R):5'- GTATCCAGGGCATAGCTATACAG -3'
Posted On2018-02-28