Incidental Mutation 'R6235:Zfp36l1'
ID504895
Institutional Source Beutler Lab
Gene Symbol Zfp36l1
Ensembl Gene ENSMUSG00000021127
Gene Namezinc finger protein 36, C3H type-like 1
SynonymsTIS11b, D530020L18Rik, Brf1, cMG1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6235 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location80107754-80113013 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 80112822 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 18 (C18*)
Ref Sequence ENSEMBL: ENSMUSP00000151682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021552] [ENSMUST00000165114] [ENSMUST00000218835] [ENSMUST00000219642]
Predicted Effect probably null
Transcript: ENSMUST00000021552
AA Change: C18*
SMART Domains Protein: ENSMUSP00000021552
Gene: ENSMUSG00000021127
AA Change: C18*

DomainStartEndE-ValueType
Pfam:Tis11B_N 1 107 3.2e-50 PFAM
ZnF_C3H1 114 141 1.07e-9 SMART
ZnF_C3H1 152 179 2.1e-8 SMART
low complexity region 201 218 N/A INTRINSIC
low complexity region 222 231 N/A INTRINSIC
low complexity region 290 318 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165114
AA Change: C18*
SMART Domains Protein: ENSMUSP00000127522
Gene: ENSMUSG00000021127
AA Change: C18*

DomainStartEndE-ValueType
Pfam:Tis11B_N 1 105 2.7e-33 PFAM
ZnF_C3H1 114 141 1.07e-9 SMART
ZnF_C3H1 152 179 2.1e-8 SMART
low complexity region 201 218 N/A INTRINSIC
low complexity region 222 231 N/A INTRINSIC
low complexity region 290 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181323
Predicted Effect probably benign
Transcript: ENSMUST00000218835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219015
Predicted Effect probably null
Transcript: ENSMUST00000219642
AA Change: C18*
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TIS11 family of early response genes, which are induced by various agonists such as the phorbol ester TPA and the polypeptide mitogen EGF. This gene is well conserved across species and has a promoter that contains motifs seen in other early-response genes. The encoded protein contains a distinguishing putative zinc finger domain with a repeating cys-his motif. This putative nuclear transcription factor most likely functions in regulating the response to growth factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality with failure of chorioallantoic fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T C 12: 113,491,710 F716L probably benign Het
Akip1 A G 7: 109,707,413 M106V probably benign Het
Aldh1l1 A T 6: 90,564,457 I278F probably benign Het
Aplnr A G 2: 85,137,626 T332A probably benign Het
Aqp4 A G 18: 15,398,113 V197A probably damaging Het
Arid4a A T 12: 71,069,772 probably null Het
Baiap2 A T 11: 119,981,408 N99Y probably damaging Het
Ceacam1 A T 7: 25,471,792 probably null Het
Cep78 T C 19: 15,976,486 probably null Het
Cldn3 T C 5: 134,986,719 F92S possibly damaging Het
Clec16a C A 16: 10,694,635 P812Q probably damaging Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Copg2 A G 6: 30,816,071 I443T probably damaging Het
Crhbp C A 13: 95,443,850 A81S probably damaging Het
Csad A T 15: 102,178,606 V410D probably damaging Het
Ctps G A 4: 120,558,806 L207F probably benign Het
Dab2ip A G 2: 35,723,087 E1003G probably damaging Het
Ddx31 C G 2: 28,844,842 A5G probably benign Het
Dnah12 A T 14: 26,854,804 I3004F probably damaging Het
Fbxo15 A G 18: 84,980,904 probably benign Het
Fbxw28 C A 9: 109,326,190 W356C probably damaging Het
Gimap6 G T 6: 48,702,457 T215K probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Hunk A G 16: 90,432,706 I152V probably damaging Het
Itk T C 11: 46,336,428 E456G probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lars2 T C 9: 123,411,880 V204A probably damaging Het
Lipo1 A G 19: 33,783,563 Y140H probably damaging Het
Lrp1 G A 10: 127,588,177 R809W probably damaging Het
Magi3 C T 3: 104,016,068 G1111D probably damaging Het
Mis18bp1 A T 12: 65,158,408 V47E probably damaging Het
Mpdz T C 4: 81,385,281 E140G probably damaging Het
Myo1d T C 11: 80,692,944 I81V probably benign Het
Nek10 T A 14: 14,821,113 Y26* probably null Het
Ntng2 C A 2: 29,227,979 E152D probably damaging Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Olfr1490 C A 19: 13,654,781 C117* probably null Het
Otud3 A T 4: 138,901,901 V185D probably damaging Het
Parp6 C T 9: 59,630,815 R248W probably benign Het
Pcdhga7 A G 18: 37,716,430 T497A probably benign Het
Ppp1r18 A G 17: 35,873,877 E140G probably damaging Het
Prl3b1 T C 13: 27,247,945 L151P probably damaging Het
Pth1r C T 9: 110,722,316 E572K possibly damaging Het
Ptprq T A 10: 107,635,338 T1401S possibly damaging Het
Rad51ap2 A G 12: 11,457,516 T480A possibly damaging Het
Rax T A 18: 65,935,161 Q291L unknown Het
Reck T C 4: 43,937,450 L734P probably damaging Het
Rgmb A G 17: 15,820,819 F169L probably damaging Het
Rhobtb3 T C 13: 75,892,910 I426M probably damaging Het
Ring1 C A 17: 34,023,306 A76S probably damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rpusd2 A G 2: 119,034,857 I12V probably benign Het
Rragd T C 4: 32,995,985 V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 G T 7: 29,116,181 Q95K probably benign Het
S1pr4 T A 10: 81,498,882 N253Y possibly damaging Het
Scn3a A C 2: 65,461,335 V1689G probably damaging Het
Sdhb A G 4: 140,973,673 N147D probably damaging Het
Sdk1 A T 5: 142,034,426 H913L possibly damaging Het
Serpina3i T A 12: 104,266,532 M232K probably damaging Het
Sipa1l2 A T 8: 125,474,871 V646E probably damaging Het
Slc38a1 A T 15: 96,578,792 I396N probably benign Het
Slc6a13 A T 6: 121,302,794 E42D probably benign Het
Stard9 G A 2: 120,713,546 V4442M probably damaging Het
Sumo3 T A 10: 77,616,237 probably benign Het
Syngap1 A G 17: 26,958,130 I356V probably benign Het
Tcam1 C T 11: 106,284,054 Q112* probably null Het
Tdp2 T A 13: 24,840,395 L225* probably null Het
Tmprss7 A G 16: 45,658,122 V747A probably benign Het
Ugt2b34 T A 5: 86,906,364 Y186F probably benign Het
Usp37 G T 1: 74,475,133 S293* probably null Het
Vmn1r36 A G 6: 66,716,246 I109T probably benign Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Zfp959 T C 17: 55,897,427 Y152H probably damaging Het
Zfyve26 A T 12: 79,249,599 C1949S probably damaging Het
Zswim9 T A 7: 13,261,603 E209V probably damaging Het
Other mutations in Zfp36l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp36l1 APN 12 80110464 missense probably damaging 0.97
brontosouris UTSW 12 80112822 nonsense probably null
R4714:Zfp36l1 UTSW 12 80110496 missense possibly damaging 0.92
R4898:Zfp36l1 UTSW 12 80110524 missense probably benign 0.37
R5908:Zfp36l1 UTSW 12 80109675 missense possibly damaging 0.85
R6173:Zfp36l1 UTSW 12 80109546 unclassified probably null
RF014:Zfp36l1 UTSW 12 80109744 missense probably benign 0.08
Z1177:Zfp36l1 UTSW 12 80109657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCTGGGACCTGAAACTTAAG -3'
(R):5'- ACCCACCAAATCTTATAAATTGGGC -3'

Sequencing Primer
(F):5'- ACCTGAAACTTAAGTGCGAGG -3'
(R):5'- AATCTTATAAATTGGGCTTTGCGCG -3'
Posted On2018-02-28