Incidental Mutation 'R6235:Scn3a'
ID504847
Institutional Source Beutler Lab
Gene Symbol Scn3a
Ensembl Gene ENSMUSG00000057182
Gene Namesodium channel, voltage-gated, type III, alpha
SynonymsNav1.3, LOC381367
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6235 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location65457118-65567627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65461335 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1689 (V1689G)
Ref Sequence ENSEMBL: ENSMUSP00000097647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066432] [ENSMUST00000100069]
Predicted Effect probably damaging
Transcript: ENSMUST00000066432
AA Change: V1689G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065023
Gene: ENSMUSG00000057182
AA Change: V1689G

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100069
AA Change: V1689G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097647
Gene: ENSMUSG00000057182
AA Change: V1689G

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Meta Mutation Damage Score 0.2889 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality of most mutants by weaning. Heterozygous mice exhibit improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T C 12: 113,491,710 F716L probably benign Het
Akip1 A G 7: 109,707,413 M106V probably benign Het
Aldh1l1 A T 6: 90,564,457 I278F probably benign Het
Aplnr A G 2: 85,137,626 T332A probably benign Het
Aqp4 A G 18: 15,398,113 V197A probably damaging Het
Arid4a A T 12: 71,069,772 probably null Het
Baiap2 A T 11: 119,981,408 N99Y probably damaging Het
Ceacam1 A T 7: 25,471,792 probably null Het
Cep78 T C 19: 15,976,486 probably null Het
Cldn3 T C 5: 134,986,719 F92S possibly damaging Het
Clec16a C A 16: 10,694,635 P812Q probably damaging Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Copg2 A G 6: 30,816,071 I443T probably damaging Het
Crhbp C A 13: 95,443,850 A81S probably damaging Het
Csad A T 15: 102,178,606 V410D probably damaging Het
Ctps G A 4: 120,558,806 L207F probably benign Het
Dab2ip A G 2: 35,723,087 E1003G probably damaging Het
Ddx31 C G 2: 28,844,842 A5G probably benign Het
Dnah12 A T 14: 26,854,804 I3004F probably damaging Het
Fbxo15 A G 18: 84,980,904 probably benign Het
Fbxw28 C A 9: 109,326,190 W356C probably damaging Het
Gimap6 G T 6: 48,702,457 T215K probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Hunk A G 16: 90,432,706 I152V probably damaging Het
Itk T C 11: 46,336,428 E456G probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lars2 T C 9: 123,411,880 V204A probably damaging Het
Lipo1 A G 19: 33,783,563 Y140H probably damaging Het
Lrp1 G A 10: 127,588,177 R809W probably damaging Het
Magi3 C T 3: 104,016,068 G1111D probably damaging Het
Mis18bp1 A T 12: 65,158,408 V47E probably damaging Het
Mpdz T C 4: 81,385,281 E140G probably damaging Het
Myo1d T C 11: 80,692,944 I81V probably benign Het
Nek10 T A 14: 14,821,113 Y26* probably null Het
Ntng2 C A 2: 29,227,979 E152D probably damaging Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Olfr1490 C A 19: 13,654,781 C117* probably null Het
Otud3 A T 4: 138,901,901 V185D probably damaging Het
Parp6 C T 9: 59,630,815 R248W probably benign Het
Pcdhga7 A G 18: 37,716,430 T497A probably benign Het
Ppp1r18 A G 17: 35,873,877 E140G probably damaging Het
Prl3b1 T C 13: 27,247,945 L151P probably damaging Het
Pth1r C T 9: 110,722,316 E572K possibly damaging Het
Ptprq T A 10: 107,635,338 T1401S possibly damaging Het
Rad51ap2 A G 12: 11,457,516 T480A possibly damaging Het
Rax T A 18: 65,935,161 Q291L unknown Het
Reck T C 4: 43,937,450 L734P probably damaging Het
Rgmb A G 17: 15,820,819 F169L probably damaging Het
Rhobtb3 T C 13: 75,892,910 I426M probably damaging Het
Ring1 C A 17: 34,023,306 A76S probably damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rpusd2 A G 2: 119,034,857 I12V probably benign Het
Rragd T C 4: 32,995,985 V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 G T 7: 29,116,181 Q95K probably benign Het
S1pr4 T A 10: 81,498,882 N253Y possibly damaging Het
Sdhb A G 4: 140,973,673 N147D probably damaging Het
Sdk1 A T 5: 142,034,426 H913L possibly damaging Het
Serpina3i T A 12: 104,266,532 M232K probably damaging Het
Sipa1l2 A T 8: 125,474,871 V646E probably damaging Het
Slc38a1 A T 15: 96,578,792 I396N probably benign Het
Slc6a13 A T 6: 121,302,794 E42D probably benign Het
Stard9 G A 2: 120,713,546 V4442M probably damaging Het
Sumo3 T A 10: 77,616,237 probably benign Het
Syngap1 A G 17: 26,958,130 I356V probably benign Het
Tcam1 C T 11: 106,284,054 Q112* probably null Het
Tdp2 T A 13: 24,840,395 L225* probably null Het
Tmprss7 A G 16: 45,658,122 V747A probably benign Het
Ugt2b34 T A 5: 86,906,364 Y186F probably benign Het
Usp37 G T 1: 74,475,133 S293* probably null Het
Vmn1r36 A G 6: 66,716,246 I109T probably benign Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Zfp36l1 G T 12: 80,112,822 C18* probably null Het
Zfp959 T C 17: 55,897,427 Y152H probably damaging Het
Zfyve26 A T 12: 79,249,599 C1949S probably damaging Het
Zswim9 T A 7: 13,261,603 E209V probably damaging Het
Other mutations in Scn3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Scn3a APN 2 65497392 missense probably benign 0.05
IGL01086:Scn3a APN 2 65470159 missense probably benign 0.27
IGL01141:Scn3a APN 2 65495113 missense possibly damaging 0.73
IGL01150:Scn3a APN 2 65497365 splice site probably null
IGL01564:Scn3a APN 2 65461446 missense probably damaging 1.00
IGL01594:Scn3a APN 2 65461431 missense probably damaging 1.00
IGL01751:Scn3a APN 2 65461252 missense possibly damaging 0.87
IGL01803:Scn3a APN 2 65521783 unclassified probably benign
IGL01822:Scn3a APN 2 65495264 missense probably damaging 1.00
IGL02063:Scn3a APN 2 65461510 missense probably damaging 1.00
IGL02142:Scn3a APN 2 65526621 missense possibly damaging 0.95
IGL02198:Scn3a APN 2 65508489 missense probably benign 0.12
IGL02501:Scn3a APN 2 65526555 missense possibly damaging 0.82
IGL02608:Scn3a APN 2 65524166 nonsense probably null
IGL02645:Scn3a APN 2 65514527 missense probably benign 0.12
IGL02653:Scn3a APN 2 65461187 missense probably damaging 1.00
IGL03077:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03099:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03299:Scn3a APN 2 65497516 missense probably benign 0.01
IGL03327:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03346:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03355:Scn3a APN 2 65460568 missense possibly damaging 0.91
curtsey UTSW 2 65464836 missense probably damaging 1.00
dip UTSW 2 65524179 missense probably benign 0.01
Regime UTSW 2 65524850 missense possibly damaging 0.93
Willpower UTSW 2 65525754 missense possibly damaging 0.92
R0019:Scn3a UTSW 2 65461701 missense probably damaging 1.00
R0316:Scn3a UTSW 2 65460829 missense probably damaging 1.00
R0374:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R0414:Scn3a UTSW 2 65525982 splice site probably benign
R0609:Scn3a UTSW 2 65536510 missense probably damaging 0.96
R0613:Scn3a UTSW 2 65472284 missense possibly damaging 0.92
R0645:Scn3a UTSW 2 65524850 missense possibly damaging 0.93
R0665:Scn3a UTSW 2 65484411 missense probably null 0.00
R0667:Scn3a UTSW 2 65484411 missense probably null 0.00
R0710:Scn3a UTSW 2 65469046 missense probably damaging 0.99
R1202:Scn3a UTSW 2 65506147 missense probably benign 0.07
R1440:Scn3a UTSW 2 65529441 missense possibly damaging 0.95
R1447:Scn3a UTSW 2 65469980 missense probably damaging 1.00
R1564:Scn3a UTSW 2 65514635 missense probably damaging 0.98
R1595:Scn3a UTSW 2 65498979 missense probably damaging 0.99
R1775:Scn3a UTSW 2 65472342 missense probably damaging 1.00
R1781:Scn3a UTSW 2 65472385 missense probably damaging 1.00
R1822:Scn3a UTSW 2 65484372 missense probably damaging 1.00
R1924:Scn3a UTSW 2 65461534 missense probably damaging 1.00
R2061:Scn3a UTSW 2 65461308 missense probably damaging 1.00
R2070:Scn3a UTSW 2 65520866 missense possibly damaging 0.72
R2174:Scn3a UTSW 2 65507206 missense probably damaging 0.99
R2656:Scn3a UTSW 2 65526518 missense probably damaging 0.99
R2680:Scn3a UTSW 2 65536536 missense probably benign 0.04
R3882:Scn3a UTSW 2 65482279 missense probably benign 0.03
R4019:Scn3a UTSW 2 65525951 intron probably benign
R4106:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4108:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4109:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4225:Scn3a UTSW 2 65536427 missense probably damaging 0.99
R4419:Scn3a UTSW 2 65466960 missense probably damaging 1.00
R4552:Scn3a UTSW 2 65524179 missense probably benign 0.01
R4687:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R4780:Scn3a UTSW 2 65506193 missense probably damaging 1.00
R4820:Scn3a UTSW 2 65461278 missense probably damaging 1.00
R4856:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4886:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4914:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4915:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4918:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R5088:Scn3a UTSW 2 65472299 missense probably damaging 1.00
R5101:Scn3a UTSW 2 65461506 missense probably damaging 1.00
R5128:Scn3a UTSW 2 65508518 missense probably benign 0.08
R5132:Scn3a UTSW 2 65468204 missense probably benign 0.09
R5297:Scn3a UTSW 2 65469034 missense possibly damaging 0.83
R5595:Scn3a UTSW 2 65460713 missense probably benign
R5699:Scn3a UTSW 2 65507264 missense possibly damaging 0.54
R5730:Scn3a UTSW 2 65495260 missense probably benign 0.00
R5735:Scn3a UTSW 2 65482278 missense probably damaging 0.98
R5735:Scn3a UTSW 2 65484459 missense probably benign 0.09
R5855:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R5888:Scn3a UTSW 2 65497398 missense probably benign 0.06
R5898:Scn3a UTSW 2 65514695 missense probably damaging 0.96
R5935:Scn3a UTSW 2 65464836 missense probably damaging 1.00
R5970:Scn3a UTSW 2 65494781 intron probably benign
R6214:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6215:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6307:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R6355:Scn3a UTSW 2 65461299 missense probably damaging 0.99
R6376:Scn3a UTSW 2 65461499 missense possibly damaging 0.88
R6517:Scn3a UTSW 2 65497563 missense possibly damaging 0.73
R6775:Scn3a UTSW 2 65521815 missense possibly damaging 0.82
R6893:Scn3a UTSW 2 65525754 missense possibly damaging 0.92
R6986:Scn3a UTSW 2 65508618 missense probably damaging 0.97
R7065:Scn3a UTSW 2 65464855 missense probably benign
R7078:Scn3a UTSW 2 65497600 missense probably damaging 1.00
R7146:Scn3a UTSW 2 65483142 missense probably damaging 1.00
R7240:Scn3a UTSW 2 65469042 missense possibly damaging 0.77
R7294:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R7352:Scn3a UTSW 2 65525701 missense possibly damaging 0.51
R7636:Scn3a UTSW 2 65497689 missense probably damaging 1.00
R7708:Scn3a UTSW 2 65483168 missense possibly damaging 0.47
R7733:Scn3a UTSW 2 65508650 missense probably benign 0.08
R7761:Scn3a UTSW 2 65529454 missense possibly damaging 0.95
R7792:Scn3a UTSW 2 65466990 nonsense probably null
R7828:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R7875:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7884:Scn3a UTSW 2 65536515 missense probably damaging 0.96
R7958:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7967:Scn3a UTSW 2 65536515 missense probably damaging 0.96
X0062:Scn3a UTSW 2 65467001 missense probably damaging 0.98
X0062:Scn3a UTSW 2 65524847 nonsense probably null
Z1177:Scn3a UTSW 2 65498892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATGAACTGGGTGGCGTC -3'
(R):5'- GGGATGTCCAACTTTGCCTATG -3'

Sequencing Primer
(F):5'- TCAGGGTCGAACTTCTCCCAG -3'
(R):5'- CTGCCTGTTCCAAATCAC -3'
Posted On2018-02-28