Incidental Mutation 'R6250:Mxra8'
ID505908
Institutional Source Beutler Lab
Gene Symbol Mxra8
Ensembl Gene ENSMUSG00000029070
Gene Namematrix-remodelling associated 8
Synonyms
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6250 (G1)
Quality Score152.008
Status Validated
Chromosome4
Chromosomal Location155839680-155844088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 155841089 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 82 (R82L)
Ref Sequence ENSEMBL: ENSMUSP00000114929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030947] [ENSMUST00000141883]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030947
AA Change: R85L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030947
Gene: ENSMUSG00000029070
AA Change: R85L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 38 156 6.16e-4 SMART
IG 170 291 9.71e-2 SMART
transmembrane domain 340 362 N/A INTRINSIC
low complexity region 371 384 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141766
Predicted Effect possibly damaging
Transcript: ENSMUST00000141883
AA Change: R82L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114929
Gene: ENSMUSG00000029070
AA Change: R82L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 35 153 6.16e-4 SMART
IG 167 288 9.71e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143886
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Mxra8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mxra8 APN 4 155842563 missense probably benign 0.06
IGL01871:Mxra8 APN 4 155842801 missense probably benign
IGL02900:Mxra8 APN 4 155841119 missense possibly damaging 0.52
IGL02900:Mxra8 APN 4 155841211 splice site probably null
Buffet UTSW 4 155843136 missense possibly damaging 0.89
R0206:Mxra8 UTSW 4 155842596 missense probably damaging 0.97
R0206:Mxra8 UTSW 4 155842596 missense probably damaging 0.97
R0513:Mxra8 UTSW 4 155841733 missense probably benign 0.00
R1318:Mxra8 UTSW 4 155841499 missense probably damaging 1.00
R1414:Mxra8 UTSW 4 155841007 missense probably damaging 0.99
R1775:Mxra8 UTSW 4 155843074 missense probably damaging 1.00
R2473:Mxra8 UTSW 4 155842043 missense probably damaging 0.99
R4270:Mxra8 UTSW 4 155841137 missense probably damaging 0.96
R4519:Mxra8 UTSW 4 155842983 critical splice donor site probably null
R4844:Mxra8 UTSW 4 155842694 missense probably benign 0.19
R4849:Mxra8 UTSW 4 155840874 intron probably benign
R4912:Mxra8 UTSW 4 155840904 splice site probably null
R4929:Mxra8 UTSW 4 155842661 missense probably damaging 1.00
R5567:Mxra8 UTSW 4 155841008 missense probably damaging 1.00
R5665:Mxra8 UTSW 4 155842921 missense probably benign 0.01
R5913:Mxra8 UTSW 4 155843303 critical splice acceptor site probably null
R6857:Mxra8 UTSW 4 155843136 missense possibly damaging 0.89
R7142:Mxra8 UTSW 4 155843062 missense probably benign 0.23
R7658:Mxra8 UTSW 4 155842963 missense probably benign 0.04
R7842:Mxra8 UTSW 4 155842910 missense probably damaging 1.00
R8182:Mxra8 UTSW 4 155841132 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTATCCCCTATCCAGCTGTGG -3'
(R):5'- CCAAGGTTTCAGTTTCTGCCAAAG -3'

Sequencing Primer
(F):5'- AGGGTCCACTCCTGTCCTAG -3'
(R):5'- AAAGTTTCAGCCCACTACGGTTC -3'
Posted On2018-02-28