Mutagenetix > Incidental Mutations

Incidental Mutation 'R6288:Epha2'

509229

Institutional Source

Beutler Lab

Gene Symbol

Epha2

Ensembl Gene

ENSMUSG00000006445

Gene Name

Eph receptor A2

Synonyms

Myk2, Eck, Sek-2, Sek2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.710) question?

Stock #

R6288 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141301240-141329384 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 141317033 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 382 (A382V)

Ref Sequence

ENSEMBL: ENSMUSP00000006614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006614]

Predicted Effect

probably benign
Transcript: ENSMUST00000006614
AA Change: A382V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000006614
Gene: ENSMUSG00000006445
AA Change: A382V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
EPH_lbd	27	200	1.31e-112	SMART
FN3	330	420	1.16e-6	SMART
FN3	437	517	3.73e-10	SMART
Pfam:EphA2_TM	538	611	5.9e-22	PFAM
TyrKc	614	872	2.23e-135	SMART
SAM	902	969	1.5e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149002

Meta Mutation Damage Score

0.0706

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

97% (32/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Mutations in this gene are the cause of certain genetically-related cataract disorders.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal angiogenesis. Mice homozygous for a gene trap allele exhibit increased incidence of chemically-induced tumors, increased metastatic potential, and age-related cataracts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	G	T	11: 58,293,595	D380Y	probably damaging	Het
4931406B18Rik	T	A	7: 43,498,125	E274V	probably damaging	Het
Ankrd44	A	G	1: 54,763,763	L192P	probably damaging	Het
Apbb1	T	A	7: 105,559,227	I624F	probably damaging	Het
Asxl2	A	G	12: 3,476,040	K219E	possibly damaging	Het
Bean1	T	A	8: 104,210,990	L33Q	probably damaging	Het
Col22a1	T	C	15: 71,894,869		probably null	Het
Col6a4	T	C	9: 106,068,263	D884G	probably damaging	Het
Crocc2	A	G	1: 93,194,505	R707G	probably benign	Het
Cts7	C	T	13: 61,352,770	G321E	probably damaging	Het
Cyp2d9	C	T	15: 82,456,415	H422Y	probably damaging	Het
Fam151a	A	C	4: 106,748,144	T568P	probably damaging	Het
Fbln2	A	T	6: 91,233,281	Y69F	probably damaging	Het
Flg2	A	T	3: 93,203,785	H1040L	unknown	Het
Gm28710	T	A	5: 16,856,285	C738S	possibly damaging	Het
Gucy2g	T	C	19: 55,227,513	T476A	probably benign	Het
Hist1h3f	A	G	13: 23,544,494	T4A	probably benign	Het
Ighv1-20	C	T	12: 114,723,899	G75D	probably benign	Het
Inpp5b	G	A	4: 124,785,227	V476I	probably benign	Het
Nrxn2	T	A	19: 6,490,561	L855Q	probably damaging	Het
Olfr1097	A	G	2: 86,890,882	F98L	probably benign	Het
Olfr597	A	G	7: 103,321,079	I223V	probably damaging	Het
Pcolce2	T	A	9: 95,681,593	Y211N	probably damaging	Het
Phf21b	A	C	15: 84,855,071		probably benign	Het
Rbm8a2	T	C	1: 175,978,545	E122G	probably benign	Het
Rimbp3	C	T	16: 17,212,908	P1399S	probably benign	Het
Slc38a1	A	G	15: 96,586,878	V267A	probably benign	Het
Sox11	A	G	12: 27,342,333	F26L	possibly damaging	Het
Ssbp3	T	A	4: 107,046,080		probably null	Het
Trim12c	C	T	7: 104,346,729	V146I	probably benign	Het
Trrap	C	A	5: 144,811,992	T1543K	probably damaging	Het
Zfp473	C	A	7: 44,733,534	K457N	probably damaging	Het

Other mutations in Epha2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02148:Epha2	APN	4	141318524	missense	probably damaging	1.00
IGL02812:Epha2	APN	4	141318919	splice site	probably benign
IGL03377:Epha2	APN	4	141322412	missense	probably benign	0.08
R0165:Epha2	UTSW	4	141321892	critical splice donor site	probably null
R0321:Epha2	UTSW	4	141308405	missense	probably damaging	1.00
R1584:Epha2	UTSW	4	141322047	splice site	probably null
R1586:Epha2	UTSW	4	141318605	splice site	probably benign
R1695:Epha2	UTSW	4	141306517	missense	possibly damaging	0.74
R1721:Epha2	UTSW	4	141322652	missense	probably damaging	1.00
R1731:Epha2	UTSW	4	141321752	missense	possibly damaging	0.81
R1813:Epha2	UTSW	4	141308546	missense	possibly damaging	0.86
R1875:Epha2	UTSW	4	141308979	missense	probably benign	0.02
R2226:Epha2	UTSW	4	141321237	missense	probably damaging	1.00
R2314:Epha2	UTSW	4	141319014	missense	probably damaging	1.00
R2342:Epha2	UTSW	4	141323531	missense	probably benign	0.00
R3872:Epha2	UTSW	4	141308405	missense	probably damaging	1.00
R3927:Epha2	UTSW	4	141306550	missense	probably damaging	1.00
R4688:Epha2	UTSW	4	141318981	missense	probably benign
R4795:Epha2	UTSW	4	141322416	splice site	probably null
R4974:Epha2	UTSW	4	141321705	missense	probably damaging	0.99
R5055:Epha2	UTSW	4	141309069	missense	probably benign	0.09
R5123:Epha2	UTSW	4	141308865	missense	possibly damaging	0.71
R5424:Epha2	UTSW	4	141318940	nonsense	probably null
R5522:Epha2	UTSW	4	141308556	missense	probably damaging	1.00
R5657:Epha2	UTSW	4	141323494	missense	probably damaging	1.00
R5717:Epha2	UTSW	4	141322071	missense	probably benign
R5864:Epha2	UTSW	4	141308427	missense	probably damaging	0.98
R6151:Epha2	UTSW	4	141318480	critical splice acceptor site	probably null
R6244:Epha2	UTSW	4	141316912	missense	probably benign	0.00
R6696:Epha2	UTSW	4	141321539	missense	probably benign
R6817:Epha2	UTSW	4	141308994	missense	probably damaging	0.98
R6875:Epha2	UTSW	4	141328468	missense	probably damaging	1.00
R6910:Epha2	UTSW	4	141321513	missense	probably damaging	1.00
R6925:Epha2	UTSW	4	141308757	missense	probably benign
R7330:Epha2	UTSW	4	141308453	missense	probably benign	0.00
R7977:Epha2	UTSW	4	141308480	missense	probably damaging	1.00
R7987:Epha2	UTSW	4	141308480	missense	probably damaging	1.00
R8081:Epha2	UTSW	4	141322294	missense	probably damaging	1.00
RF024:Epha2	UTSW	4	141323406	critical splice acceptor site	unknown
Z1177:Epha2	UTSW	4	141318998	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CGTGAGTCTTACAGAGATCCAG -3'
(R):5'- CCTGTTTGGTTAATACTGACGC -3'

Sequencing Primer
(F):5'- TGACCTCCACTCTCTGGACAGG -3'
(R):5'- TAATACTGACGCTGGCAGTC -3'

Posted On

2018-04-02