Incidental Mutation 'R1481:Cyp2f2'
ID 164369
Institutional Source Beutler Lab
Gene Symbol Cyp2f2
Ensembl Gene ENSMUSG00000052974
Gene Name cytochrome P450, family 2, subfamily f, polypeptide 2
Synonyms Cyp2f
MMRRC Submission 039534-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock # R1481 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 27119909-27133660 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27121877 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 72 (S72P)
Ref Sequence ENSEMBL: ENSMUSP00000003100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003100] [ENSMUST00000206552]
AlphaFold P33267
Predicted Effect probably benign
Transcript: ENSMUST00000003100
AA Change: S72P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003100
Gene: ENSMUSG00000052974
AA Change: S72P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:p450 31 488 3.7e-152 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153562
Predicted Effect probably benign
Transcript: ENSMUST00000206552
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to dehydrogenate 3-methylindole, an endogenous toxin derived from the fermentation of tryptophan, as well as xenobiotic substrates such as naphthalene and ethoxycoumarin. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to napthalene-induced toxicity in the lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Cyp2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Cyp2f2 APN 7 27121929 missense probably damaging 0.98
IGL00953:Cyp2f2 APN 7 27129817 missense possibly damaging 0.47
IGL01781:Cyp2f2 APN 7 27130421 missense probably benign 0.20
IGL02817:Cyp2f2 APN 7 27129315 missense probably damaging 1.00
IGL03027:Cyp2f2 APN 7 27132571 missense possibly damaging 0.95
R0464:Cyp2f2 UTSW 7 27132537 missense probably benign 0.00
R1635:Cyp2f2 UTSW 7 27129724 missense probably benign 0.11
R1826:Cyp2f2 UTSW 7 27132562 missense probably damaging 1.00
R1989:Cyp2f2 UTSW 7 27129203 missense probably damaging 1.00
R5098:Cyp2f2 UTSW 7 27129879 missense possibly damaging 0.52
R6305:Cyp2f2 UTSW 7 27129224 missense probably damaging 1.00
R6472:Cyp2f2 UTSW 7 27129224 missense probably damaging 1.00
R7132:Cyp2f2 UTSW 7 27132568 missense probably benign 0.00
R7599:Cyp2f2 UTSW 7 27131359 critical splice donor site probably null
R7814:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7823:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7824:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7825:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R8141:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R8142:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R8143:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R8351:Cyp2f2 UTSW 7 27121869 missense probably damaging 1.00
R8809:Cyp2f2 UTSW 7 27132570 missense probably damaging 0.99
R9095:Cyp2f2 UTSW 7 27131242 missense possibly damaging 0.83
R9548:Cyp2f2 UTSW 7 27129745 missense probably benign 0.45
X0064:Cyp2f2 UTSW 7 27133284 missense probably damaging 1.00
Z1177:Cyp2f2 UTSW 7 27121907 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CACTATGGATGGTGTGAGCACAGC -3'
(R):5'- ACCTAGATATGCAAGGGCTAGAGGC -3'

Sequencing Primer
(F):5'- TGTGAGCACAGCCATCTTG -3'
(R):5'- CTAGAGGCTGGAGGAGGTG -3'
Posted On 2014-03-28