Incidental Mutation 'R6352:Mpped1'
ID513302
Institutional Source Beutler Lab
Gene Symbol Mpped1
Ensembl Gene ENSMUSG00000041708
Gene Namemetallophosphoesterase domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location83779467-83858494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83836363 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 8 (D8G)
Ref Sequence ENSEMBL: ENSMUSP00000126242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046168] [ENSMUST00000109470] [ENSMUST00000123387] [ENSMUST00000125739] [ENSMUST00000148868] [ENSMUST00000163723] [ENSMUST00000172115] [ENSMUST00000172398]
Predicted Effect probably damaging
Transcript: ENSMUST00000046168
AA Change: D166G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041981
Gene: ENSMUSG00000041708
AA Change: D166G

DomainStartEndE-ValueType
Pfam:Metallophos 90 288 1e-13 PFAM
Pfam:Metallophos_2 91 314 8.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109470
AA Change: D166G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105096
Gene: ENSMUSG00000041708
AA Change: D166G

DomainStartEndE-ValueType
Pfam:Metallophos 90 288 1.9e-13 PFAM
Pfam:Metallophos_2 91 318 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123387
SMART Domains Protein: ENSMUSP00000123230
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
PDB:3RL3|A 33 137 2e-54 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000125739
AA Change: D8G

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131463
Gene: ENSMUSG00000041708
AA Change: D8G

DomainStartEndE-ValueType
Pfam:Metallophos 5 130 2.2e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148868
AA Change: D83G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131679
Gene: ENSMUSG00000041708
AA Change: D83G

DomainStartEndE-ValueType
Pfam:Metallophos 49 203 4.6e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000150489
AA Change: D162G
SMART Domains Protein: ENSMUSP00000128786
Gene: ENSMUSG00000041708
AA Change: D162G

DomainStartEndE-ValueType
Pfam:Metallophos 87 217 6.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163723
AA Change: D8G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126242
Gene: ENSMUSG00000041708
AA Change: D8G

DomainStartEndE-ValueType
Pfam:Metallophos 5 130 3e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000171560
AA Change: D82G
SMART Domains Protein: ENSMUSP00000125835
Gene: ENSMUSG00000041708
AA Change: D82G

DomainStartEndE-ValueType
Pfam:Metallophos 7 147 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172115
SMART Domains Protein: ENSMUSP00000132518
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
PDB:3RL3|A 33 136 1e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172398
SMART Domains Protein: ENSMUSP00000131333
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
PDB:3RL3|A 33 140 2e-47 PDB
SCOP:d4kbpa2 84 133 9e-3 SMART
Meta Mutation Damage Score 0.1802 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Mpped1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Mpped1 APN 15 83800119 missense probably damaging 1.00
IGL01402:Mpped1 APN 15 83792213 missense possibly damaging 0.94
IGL02004:Mpped1 APN 15 83800156 missense probably damaging 1.00
R0336:Mpped1 UTSW 15 83836282 missense probably damaging 1.00
R1582:Mpped1 UTSW 15 83791990 unclassified probably benign
R1635:Mpped1 UTSW 15 83791990 unclassified probably benign
R1636:Mpped1 UTSW 15 83791990 unclassified probably benign
R1637:Mpped1 UTSW 15 83791990 unclassified probably benign
R1778:Mpped1 UTSW 15 83791990 unclassified probably benign
R3787:Mpped1 UTSW 15 83796583 intron probably benign
R4114:Mpped1 UTSW 15 83796709 intron probably benign
R4116:Mpped1 UTSW 15 83796709 intron probably benign
R4977:Mpped1 UTSW 15 83796706 intron probably benign
R4982:Mpped1 UTSW 15 83836327 missense probably damaging 1.00
R6765:Mpped1 UTSW 15 83836383 missense probably damaging 1.00
R7499:Mpped1 UTSW 15 83800050 missense probably damaging 1.00
R8056:Mpped1 UTSW 15 83836462 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CAGTGATTGTCCCCAGCTATC -3'
(R):5'- AACTTTGGGTCCCAATGCCC -3'

Sequencing Primer
(F):5'- AGCTATCTCCCTTTGGTGGC -3'
(R):5'- AATGCCCCTGTAGGAGACTG -3'
Posted On2018-04-27