Mutagenetix > Incidental Mutations

Incidental Mutation 'R6352:Myo9b'

513288

Institutional Source

Beutler Lab

Gene Symbol

Myo9b

Ensembl Gene

ENSMUSG00000004677

Gene Name

myosin IXb

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.573) question?

Stock #

R6352 (G1)

Quality Score

154.008

Status

Validated

Chromosome

Chromosomal Location

71272714-71360713 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 71348411 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1071 (P1071L)

Ref Sequence

ENSEMBL: ENSMUSP00000148316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]

Predicted Effect

probably benign
Transcript: ENSMUST00000071935
AA Change: P1070L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: P1070L

Domain	Start	End	E-Value	Type
RA	15	114	3.7e-30	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	1.2e-3	SMART
IQ	978	1000	1.6e-5	SMART
IQ	1001	1022	4.3e-5	SMART
IQ	1023	1045	8.4e-5	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1232	1246	N/A	INTRINSIC
Blast:MYSc	1247	1323	3e-19	BLAST
low complexity region	1348	1359	N/A	INTRINSIC
coiled coil region	1563	1590	N/A	INTRINSIC
C1	1591	1639	1.7e-14	SMART
RhoGAP	1668	1843	4.7e-71	SMART
coiled coil region	1901	1925	N/A	INTRINSIC
low complexity region	1940	1952	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168839
AA Change: P1070L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: P1070L

Domain	Start	End	E-Value	Type
RA	15	114	5.79e-28	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	2.46e-1	SMART
IQ	978	1000	3.35e-3	SMART
IQ	1001	1022	8.84e-3	SMART
IQ	1023	1045	1.77e-2	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1234	1257	N/A	INTRINSIC
Blast:MYSc	1258	1334	3e-19	BLAST
low complexity region	1361	1372	N/A	INTRINSIC
low complexity region	1581	1601	N/A	INTRINSIC
C1	1605	1653	3.58e-12	SMART
RhoGAP	1682	1857	7.78e-69	SMART
coiled coil region	1915	1939	N/A	INTRINSIC
low complexity region	1954	1966	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170242
AA Change: P1070L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: P1070L

Domain	Start	End	E-Value	Type
RA	15	114	5.79e-28	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	2.46e-1	SMART
IQ	978	1000	3.35e-3	SMART
IQ	1001	1022	8.84e-3	SMART
IQ	1023	1045	1.77e-2	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1234	1257	N/A	INTRINSIC
Blast:MYSc	1258	1334	3e-19	BLAST
low complexity region	1361	1372	N/A	INTRINSIC
low complexity region	1581	1601	N/A	INTRINSIC
C1	1605	1653	3.58e-12	SMART
RhoGAP	1682	1857	7.78e-69	SMART
coiled coil region	1931	1955	N/A	INTRINSIC
low complexity region	1970	1982	N/A	INTRINSIC
low complexity region	1992	2003	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212412

Predicted Effect

probably benign
Transcript: ENSMUST00000212935
AA Change: P1071L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700122O11Rik	T	C	17: 48,037,136	S120G	probably benign	Het
Abca13	G	A	11: 9,309,139		probably null	Het
Aco1	G	A	4: 40,186,367	R593Q	probably benign	Het
Adgra3	T	A	5: 49,979,136	D669V	probably benign	Het
Adgra3	T	A	5: 49,990,250	M483L	probably benign	Het
BC005561	A	G	5: 104,520,198	E862G	probably benign	Het
Ccdc42	T	C	11: 68,594,365	V88A	probably damaging	Het
Cdh16	G	C	8: 104,616,992	S624C	probably damaging	Het
Cpt1c	A	T	7: 44,966,795		probably null	Het
Cul9	T	C	17: 46,511,315	T1795A	probably benign	Het
Dnah2	C	T	11: 69,448,227	V3098I	probably damaging	Het
Fam126b	A	G	1: 58,557,312	V38A	probably damaging	Het
Fbxl16	T	C	17: 25,818,945	L426P	probably damaging	Het
Flt4	T	C	11: 49,643,506	I1168T	probably benign	Het
Fmo5	T	C	3: 97,645,675	V313A	probably benign	Het
Foxj3	A	G	4: 119,585,778	N133S	probably damaging	Het
Gbp8	T	C	5: 105,015,060	I489M	possibly damaging	Het
Gm10801	TC	TCGAC	2: 98,663,806		probably benign	Het
Hdgfl1	T	G	13: 26,769,750	E113D	probably benign	Het
Heatr5a	A	T	12: 51,951,166	S317T	possibly damaging	Het
Insr	C	T	8: 3,173,479		probably null	Het
Iqcf5	A	G	9: 106,515,730	E62G	possibly damaging	Het
Kcnj3	G	A	2: 55,437,549	V117I	probably benign	Het
Klf9	T	A	19: 23,141,774	M7K	probably benign	Het
Mboat1	G	A	13: 30,202,420	G139E	possibly damaging	Het
Mical3	T	C	6: 120,952,473	T1811A	probably damaging	Het
Mllt10	A	C	2: 18,123,793	K117T	probably damaging	Het
Mpped1	A	G	15: 83,836,363	D8G	probably damaging	Het
Myh4	A	T	11: 67,252,282	D1012V	probably damaging	Het
Nlrp1b	T	A	11: 71,181,701	I439F	probably damaging	Het
Nlrp9a	T	A	7: 26,557,626	I134N	probably damaging	Het
Nop2	C	T	6: 125,137,207	T212M	probably benign	Het
Notch4	T	C	17: 34,567,461	C188R	probably damaging	Het
Olfr1495	A	T	19: 13,768,464	M41L	probably benign	Het
Olfr703	G	T	7: 106,845,222	V204F	probably damaging	Het
Pgd	C	T	4: 149,160,752		probably null	Het
Plet1	T	C	9: 50,501,107	S142P	probably damaging	Het
Ptk7	A	T	17: 46,576,890	W539R	probably benign	Het
Ptprd	A	T	4: 76,091,552		probably null	Het
Rgs22	T	G	15: 36,092,921	Q402P	probably damaging	Het
Rpl10a	T	C	17: 28,330,846	V167A	possibly damaging	Het
Sdr16c5	A	G	4: 4,016,421	S2P	probably benign	Het
Slc14a2	T	C	18: 78,209,094	M1V	probably null	Het
Spta1	T	A	1: 174,211,646	M1185K	possibly damaging	Het
Syde2	G	T	3: 145,998,474	E127*	probably null	Het
Ugt2b38	T	A	5: 87,424,001	R57S	possibly damaging	Het
Wdr11	C	T	7: 129,606,675	L385F	possibly damaging	Het
Wdr74	T	C	19: 8,739,458	V200A	possibly damaging	Het

Other mutations in Myo9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Myo9b	APN	8	71348735	missense	probably benign
IGL01020:Myo9b	APN	8	71352000	missense	probably benign
IGL01479:Myo9b	APN	8	71359342	missense	probably damaging	1.00
IGL01704:Myo9b	APN	8	71359642	missense	probably damaging	0.98
IGL01761:Myo9b	APN	8	71349152	missense	probably damaging	0.96
IGL01766:Myo9b	APN	8	71290517	missense	probably damaging	1.00
IGL01834:Myo9b	APN	8	71356318	missense	probably damaging	1.00
IGL01834:Myo9b	APN	8	71355257	missense	possibly damaging	0.93
IGL01838:Myo9b	APN	8	71334390	missense	probably damaging	0.99
IGL02318:Myo9b	APN	8	71354124	missense	probably damaging	0.98
IGL02333:Myo9b	APN	8	71358993	missense	possibly damaging	0.65
IGL02340:Myo9b	APN	8	71291045	missense	probably damaging	1.00
IGL02514:Myo9b	APN	8	71291006	missense	probably damaging	1.00
IGL02593:Myo9b	APN	8	71290773	missense	probably damaging	1.00
IGL03075:Myo9b	APN	8	71354527	missense	probably damaging	1.00
IGL03332:Myo9b	APN	8	71348774	missense	possibly damaging	0.78
avantgarde	UTSW	8	71344162	missense	probably damaging	1.00
Freaky	UTSW	8	71290819	missense	probably damaging	1.00
iconoclastic	UTSW	8	71290475	missense	probably benign	0.37
unconventional	UTSW	8	71348597	missense	probably benign	0.00
PIT4418001:Myo9b	UTSW	8	71322947	missense	probably damaging	1.00
PIT4651001:Myo9b	UTSW	8	71342812	missense	possibly damaging	0.83
R0023:Myo9b	UTSW	8	71333768	missense	probably damaging	1.00
R0103:Myo9b	UTSW	8	71323849	splice site	probably benign
R0103:Myo9b	UTSW	8	71323849	splice site	probably benign
R0144:Myo9b	UTSW	8	71346043	missense	probably damaging	1.00
R0207:Myo9b	UTSW	8	71355225	splice site	probably benign
R0226:Myo9b	UTSW	8	71353832	missense	probably damaging	1.00
R0227:Myo9b	UTSW	8	71344162	missense	probably damaging	1.00
R0244:Myo9b	UTSW	8	71321813	missense	probably damaging	1.00
R0277:Myo9b	UTSW	8	71355952	splice site	probably benign
R0362:Myo9b	UTSW	8	71347770	missense	probably damaging	1.00
R0689:Myo9b	UTSW	8	71330756	missense	probably damaging	1.00
R0844:Myo9b	UTSW	8	71290475	missense	probably benign	0.37
R1051:Myo9b	UTSW	8	71355822	missense	probably damaging	1.00
R1469:Myo9b	UTSW	8	71291036	missense	probably damaging	1.00
R1469:Myo9b	UTSW	8	71291036	missense	probably damaging	1.00
R1526:Myo9b	UTSW	8	71355764	missense	probably damaging	1.00
R1544:Myo9b	UTSW	8	71290976	missense	probably damaging	1.00
R1565:Myo9b	UTSW	8	71315192	missense	possibly damaging	0.46
R1645:Myo9b	UTSW	8	71322978	missense	probably damaging	1.00
R1745:Myo9b	UTSW	8	71354047	missense	probably damaging	1.00
R1820:Myo9b	UTSW	8	71333358	missense	probably damaging	1.00
R2037:Myo9b	UTSW	8	71290866	missense	probably damaging	1.00
R2050:Myo9b	UTSW	8	71290550	missense	probably damaging	1.00
R2056:Myo9b	UTSW	8	71359690	missense	possibly damaging	0.78
R2129:Myo9b	UTSW	8	71333699	missense	probably damaging	1.00
R2423:Myo9b	UTSW	8	71327940	missense	probably damaging	1.00
R2869:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2869:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2871:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2871:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2872:Myo9b	UTSW	8	71290966	missense	probably benign	0.01
R2872:Myo9b	UTSW	8	71290966	missense	probably benign	0.01
R2873:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2874:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2920:Myo9b	UTSW	8	71325857	missense	probably damaging	0.98
R2926:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2939:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2940:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3033:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3040:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3689:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3691:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3735:Myo9b	UTSW	8	71348597	missense	probably benign	0.00
R4194:Myo9b	UTSW	8	71359624	missense	possibly damaging	0.71
R4258:Myo9b	UTSW	8	71355765	missense	probably damaging	1.00
R4457:Myo9b	UTSW	8	71290999	missense	probably damaging	1.00
R4478:Myo9b	UTSW	8	71291081	missense	probably damaging	1.00
R4496:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R4544:Myo9b	UTSW	8	71327941	missense	probably damaging	1.00
R4580:Myo9b	UTSW	8	71315135	missense	probably damaging	1.00
R4736:Myo9b	UTSW	8	71356592	missense	probably damaging	1.00
R5068:Myo9b	UTSW	8	71349055	missense	probably damaging	1.00
R5124:Myo9b	UTSW	8	71355839	missense	probably damaging	1.00
R5194:Myo9b	UTSW	8	71349089	missense	probably benign	0.01
R5296:Myo9b	UTSW	8	71333388	missense	possibly damaging	0.69
R5528:Myo9b	UTSW	8	71323274	missense	probably benign	0.06
R5664:Myo9b	UTSW	8	71359882	missense	probably benign	0.13
R5677:Myo9b	UTSW	8	71343686	missense	probably damaging	1.00
R5680:Myo9b	UTSW	8	71290372	missense	probably benign	0.00
R5982:Myo9b	UTSW	8	71348396	missense	probably benign	0.05
R6344:Myo9b	UTSW	8	71327914	missense	probably damaging	1.00
R6352:Myo9b	UTSW	8	71348410	missense	probably benign	0.16
R6411:Myo9b	UTSW	8	71322955	nonsense	probably null
R6425:Myo9b	UTSW	8	71333628	missense	probably damaging	1.00
R6505:Myo9b	UTSW	8	71355857	missense	possibly damaging	0.88
R6743:Myo9b	UTSW	8	71352159	splice site	probably null
R6811:Myo9b	UTSW	8	71356578	missense	probably damaging	1.00
R6813:Myo9b	UTSW	8	71323305	missense	probably damaging	1.00
R6954:Myo9b	UTSW	8	71290819	missense	probably damaging	1.00
R7124:Myo9b	UTSW	8	71333701	nonsense	probably null
R7255:Myo9b	UTSW	8	71290891	missense	probably damaging	1.00
R7293:Myo9b	UTSW	8	71325905	missense	probably benign	0.00
R7342:Myo9b	UTSW	8	71355774	missense	probably damaging	1.00
R7451:Myo9b	UTSW	8	71352188	missense	probably benign	0.28
R7482:Myo9b	UTSW	8	71342798	missense	probably benign	0.00
R7508:Myo9b	UTSW	8	71354801	missense	probably benign	0.00
X0066:Myo9b	UTSW	8	71323898	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAGCCTTGCAAGTTGGGAG -3'
(R):5'- TCATGACTTTCAGCTGGCACTG -3'

Sequencing Primer
(F):5'- TACCCAGGTCGATATCAGCTG -3'
(R):5'- CAGCTGGCACTGTCTTTTG -3'

Posted On

2018-04-27