Incidental Mutation 'R6350:Kcnmb1'
ID514157
Institutional Source Beutler Lab
Gene Symbol Kcnmb1
Ensembl Gene ENSMUSG00000020155
Gene Namepotassium large conductance calcium-activated channel, subfamily M, beta member 1
SynonymsBK channel beta subunit, BKbeta1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location33963013-33973641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33964711 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 4 (K4R)
Ref Sequence ENSEMBL: ENSMUSP00000020362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020362]
Predicted Effect probably damaging
Transcript: ENSMUST00000020362
AA Change: K4R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020362
Gene: ENSMUSG00000020155
AA Change: K4R

DomainStartEndE-ValueType
Pfam:CaKB 7 190 5.4e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154760
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the product of this gene, the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased blood pressure, and impaired motor coordination and cerebellar function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Kcnmb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02321:Kcnmb1 APN 11 33970091 splice site probably benign
R0737:Kcnmb1 UTSW 11 33964701 start codon destroyed probably benign 0.18
R3153:Kcnmb1 UTSW 11 33966339 missense probably damaging 0.99
R6822:Kcnmb1 UTSW 11 33964686 start gained probably benign
R6995:Kcnmb1 UTSW 11 33970131 missense probably benign 0.02
R7872:Kcnmb1 UTSW 11 33966275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGTTGTTATTTGGTTGCATCCC -3'
(R):5'- CCTGAAGATGACGAATGCCTC -3'

Sequencing Primer
(F):5'- ATTTGGTTGCATCCCCTCATG -3'
(R):5'- TGTCCTGACTACCGTGACG -3'
Posted On2018-04-27