Incidental Mutation 'R6350:Nsmce4a'
ID514153
Institutional Source Beutler Lab
Gene Symbol Nsmce4a
Ensembl Gene ENSMUSG00000040331
Gene NameNSE4 homolog A, SMC5-SMC6 complex component
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location130532526-130573118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130539099 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 219 (I219K)
Ref Sequence ENSEMBL: ENSMUSP00000125300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124096] [ENSMUST00000160289]
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159694
SMART Domains Protein: ENSMUSP00000124471
Gene: ENSMUSG00000040331

DomainStartEndE-ValueType
Pfam:Nse4-Nse3_bdg 36 94 2.2e-20 PFAM
Pfam:Nse4_C 187 263 1.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160289
AA Change: I219K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125300
Gene: ENSMUSG00000040331
AA Change: I219K

DomainStartEndE-ValueType
low complexity region 2 50 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
Pfam:Nse4-Nse3_bdg 130 186 6.2e-18 PFAM
Pfam:Nse4_C 282 372 6.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207276
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Nsmce4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02693:Nsmce4a APN 7 130542808 missense probably damaging 1.00
R0302:Nsmce4a UTSW 7 130545893 critical splice donor site probably benign
R0521:Nsmce4a UTSW 7 130537002 missense probably damaging 1.00
R0529:Nsmce4a UTSW 7 130533806 missense probably benign 0.01
R1378:Nsmce4a UTSW 7 130538170 missense probably benign 0.05
R1542:Nsmce4a UTSW 7 130545893 critical splice donor site probably null
R2249:Nsmce4a UTSW 7 130539039 missense probably benign 0.00
R4860:Nsmce4a UTSW 7 130533591 unclassified probably benign
R5240:Nsmce4a UTSW 7 130537024 missense probably damaging 1.00
R5356:Nsmce4a UTSW 7 130537048 missense probably damaging 1.00
R5374:Nsmce4a UTSW 7 130538170 missense probably benign 0.05
R6115:Nsmce4a UTSW 7 130546992 missense probably benign 0.05
R6451:Nsmce4a UTSW 7 130542749
R7203:Nsmce4a UTSW 7 130539872 missense probably benign 0.00
R7422:Nsmce4a UTSW 7 130533817 missense probably benign 0.20
R8187:Nsmce4a UTSW 7 130542789 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAAGAACCTGACTCTGGACC -3'
(R):5'- ACAGCTGTCCAATGTGGTC -3'

Sequencing Primer
(F):5'- GGTACTATGTAGTCCAGCTGACC -3'
(R):5'- TTCAGTCAGTGAAAGGGG -3'
Posted On2018-04-27