Mutagenetix > Incidental Mutation

Incidental Mutation 'R6350:Cdk5r1'

514160

Institutional Source

Beutler Lab

Gene Symbol

Cdk5r1

Ensembl Gene

ENSMUSG00000048895

Gene Name

cyclin dependent kinase 5, regulatory subunit 1

Synonyms

p25, p35, D11Bwg0379e

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.677) question?

Stock #

R6350 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80367849-80372010 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80369068 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 245 (L245P)

Ref Sequence

ENSEMBL: ENSMUSP00000099514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017572] [ENSMUST00000041065] [ENSMUST00000053413] [ENSMUST00000147694]

AlphaFold

P61809

Predicted Effect

probably benign
Transcript: ENSMUST00000017572

SMART Domains

Protein: ENSMUSP00000017572
Gene: ENSMUSG00000017428

Domain	Start	End	E-Value	Type
PAM	143	320	1.6e-67	SMART
PINT	321	404	4.34e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000041065

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000053413
AA Change: L245P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099514
Gene: ENSMUSG00000048895
AA Change: L245P

Domain	Start	End	E-Value	Type
Pfam:CDK5_activator	69	294	1.6e-100	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147694

SMART Domains

Protein: ENSMUSP00000120964
Gene: ENSMUSG00000048895

Domain	Start	End	E-Value	Type
Pfam:CDK5_activator	1	138	2.3e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173797

SMART Domains

Protein: ENSMUSP00000133739
Gene: ENSMUSG00000017428

Domain	Start	End	E-Value	Type
Blast:PAM	2	58	9e-33	BLAST
PINT	59	142	4.34e-23	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene (p35) is a neuron-specific activator of cyclin-dependent kinase 5 (CDK5); the activation of CDK5 is required for proper development of the central nervous system. The p35 form of this protein is proteolytically cleaved by calpain, generating a p25 form. The cleavage of p35 into p25 results in relocalization of the protein from the cell periphery to nuclear and perinuclear regions. P25 deregulates CDK5 activity by prolonging its activation and changing its cellular location. The p25 form accumulates in the brain neurons of patients with Alzheimer's disease. This accumulation correlates with an increase in CDK5 kinase activity, and may lead to aberrantly phosphorylated forms of the microtubule-associated protein tau, which contributes to Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of the gene results in structural abnormalities of the brain such as a small corpus callosum and delaminated cerebral cortex. Mice show hyperactivity and decreased locomotion in response to stimulants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	A	G	15: 81,947,764 (GRCm39)	K554E	possibly damaging	Het
Acsf2	T	C	11: 94,449,156 (GRCm39)	M609V	probably benign	Het
Acsm3	A	G	7: 119,367,256 (GRCm39)	T30A	probably benign	Het
Adam32	T	C	8: 25,353,445 (GRCm39)	K715E	possibly damaging	Het
Cntn3	A	G	6: 102,147,579 (GRCm39)	V926A	probably damaging	Het
Csf2rb	G	A	15: 78,229,752 (GRCm39)	D440N	probably damaging	Het
D3Ertd751e	T	A	3: 41,708,278 (GRCm39)	H138Q	probably damaging	Het
D630003M21Rik	A	G	2: 158,062,415 (GRCm39)	L35P	probably damaging	Het
Faap100	A	T	11: 120,265,406 (GRCm39)	V490E	probably damaging	Het
Il3ra	A	G	14: 14,348,903 (GRCm38)	D99G	probably benign	Het
Kcnmb1	A	G	11: 33,914,711 (GRCm39)	K4R	probably damaging	Het
Larp1	T	A	11: 57,940,657 (GRCm39)	D594E	probably benign	Het
Lnpep	G	T	17: 17,783,071 (GRCm39)	H577N	probably benign	Het
Mief1	T	C	15: 80,133,804 (GRCm39)	I287T	probably damaging	Het
Mras	T	C	9: 99,293,560 (GRCm39)	S27G	probably damaging	Het
Myh7b	T	A	2: 155,470,680 (GRCm39)	C1043S	probably benign	Het
N4bp1	T	C	8: 87,588,596 (GRCm39)	D114G	probably damaging	Het
Nsmce4a	A	T	7: 130,140,829 (GRCm39)	I219K	probably damaging	Het
Nynrin	A	T	14: 56,105,533 (GRCm39)	I848F	probably benign	Het
Or2p2	T	C	13: 21,256,775 (GRCm39)	E232G	probably benign	Het
Or4f62	T	A	2: 111,986,542 (GRCm39)	I82N	probably damaging	Het
Patj	T	A	4: 98,293,855 (GRCm39)	S36T	probably benign	Het
Pcdhb15	G	A	18: 37,608,414 (GRCm39)	V549M	probably damaging	Het
Prl2c5	T	C	13: 13,357,631 (GRCm39)		probably null	Het
Ptbp3	A	T	4: 59,482,624 (GRCm39)	D386E	probably damaging	Het
Ptpra	T	C	2: 130,382,512 (GRCm39)	L451P	probably damaging	Het
Repin1	A	G	6: 48,574,562 (GRCm39)	D497G	probably damaging	Het
Ryr2	A	G	13: 11,776,282 (GRCm39)	F1085S	probably damaging	Het
Slc6a18	G	A	13: 73,826,044 (GRCm39)	A2V	possibly damaging	Het
Wee2	C	T	6: 40,432,039 (GRCm39)	R203C	probably damaging	Het
Zmynd15	T	C	11: 70,355,257 (GRCm39)	V388A	probably damaging	Het

Other mutations in Cdk5r1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02450:Cdk5r1	APN	11	80,368,666 (GRCm39)	missense	probably benign	0.09
IGL02754:Cdk5r1	APN	11	80,368,569 (GRCm39)	missense	probably benign	0.00
R0230:Cdk5r1	UTSW	11	80,368,576 (GRCm39)	missense	probably damaging	1.00
R4166:Cdk5r1	UTSW	11	80,369,035 (GRCm39)	missense	probably damaging	1.00
R5537:Cdk5r1	UTSW	11	80,368,825 (GRCm39)	missense	probably damaging	1.00
R5926:Cdk5r1	UTSW	11	80,369,128 (GRCm39)	splice site	probably null
R6841:Cdk5r1	UTSW	11	80,369,021 (GRCm39)	nonsense	probably null
R7542:Cdk5r1	UTSW	11	80,369,190 (GRCm39)	missense	probably damaging	1.00
R9612:Cdk5r1	UTSW	11	80,368,480 (GRCm39)	missense	probably benign	0.00
R9768:Cdk5r1	UTSW	11	80,368,414 (GRCm39)	missense	probably damaging	1.00
T0722:Cdk5r1	UTSW	11	80,368,707 (GRCm39)	missense	probably benign	0.38

Predicted Primers

PCR Primer
(F):5'- TACCGCCTGAAGCACTTGTC -3'
(R):5'- AGGAGGAGTCGCTTCTTGTC -3'

Sequencing Primer
(F):5'- TGAAGCACTTGTCCCCAACG -3'
(R):5'- GGAGTCGCTTCTTGTCCTCCTG -3'

Posted On

2018-04-27