Incidental Mutation 'R6350:Prl2c5'
ID514164
Institutional Source Beutler Lab
Gene Symbol Prl2c5
Ensembl Gene ENSMUSG00000055360
Gene Nameprolactin family 2, subfamily c, member 5
SynonymsMRP-4, PLF-4, Mrpplf4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location13182715-13191923 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 13183046 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021778] [ENSMUST00000126540] [ENSMUST00000151144]
Predicted Effect probably benign
Transcript: ENSMUST00000021778
SMART Domains Protein: ENSMUSP00000021778
Gene: ENSMUSG00000055360

DomainStartEndE-ValueType
Pfam:Hormone_1 16 222 2.7e-70 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126540
SMART Domains Protein: ENSMUSP00000115024
Gene: ENSMUSG00000055360

DomainStartEndE-ValueType
Pfam:Hormone_1 19 225 1.5e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143335
Predicted Effect probably benign
Transcript: ENSMUST00000151144
SMART Domains Protein: ENSMUSP00000117522
Gene: ENSMUSG00000055360

DomainStartEndE-ValueType
Pfam:Hormone_1 16 172 3.5e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Prl2c5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Prl2c5 APN 13 13189476 critical splice donor site probably null
IGL01874:Prl2c5 APN 13 13190777 missense probably benign
IGL01878:Prl2c5 APN 13 13185817 missense probably benign 0.00
R0178:Prl2c5 UTSW 13 13191805 missense probably damaging 0.98
R0276:Prl2c5 UTSW 13 13183049 intron probably benign
R0373:Prl2c5 UTSW 13 13183024 intron probably benign
R0539:Prl2c5 UTSW 13 13189321 splice site probably null
R1037:Prl2c5 UTSW 13 13185907 nonsense probably null
R1296:Prl2c5 UTSW 13 13189424 missense probably damaging 1.00
R1458:Prl2c5 UTSW 13 13190725 missense probably benign 0.40
R1557:Prl2c5 UTSW 13 13190680 missense possibly damaging 0.52
R1850:Prl2c5 UTSW 13 13185792 missense probably benign 0.40
R1866:Prl2c5 UTSW 13 13190773 splice site probably null
R1894:Prl2c5 UTSW 13 13191678 missense probably benign 0.04
R2060:Prl2c5 UTSW 13 13190653 missense probably damaging 0.99
R2330:Prl2c5 UTSW 13 13191793 missense possibly damaging 0.67
R4755:Prl2c5 UTSW 13 13189385 missense probably benign
R5229:Prl2c5 UTSW 13 13185856 missense probably damaging 1.00
R5364:Prl2c5 UTSW 13 13183042 missense probably benign 0.01
R6307:Prl2c5 UTSW 13 13190590 missense probably benign 0.01
R6927:Prl2c5 UTSW 13 13182918 splice site probably null
R7397:Prl2c5 UTSW 13 13191742 missense probably benign 0.01
R7965:Prl2c5 UTSW 13 13185884 missense probably benign 0.01
R8084:Prl2c5 UTSW 13 13185954 missense probably benign 0.20
RF020:Prl2c5 UTSW 13 13185912 missense probably benign 0.28
X0025:Prl2c5 UTSW 13 13191754 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATTATATTGCAGAGGTGGTGGAC -3'
(R):5'- AACATCCTCGTGAAGACAGG -3'

Sequencing Primer
(F):5'- ATATTGCAGAGGTGGTGGACAGTTAG -3'
(R):5'- CTCGTGAAGACAGGGGCTTG -3'
Posted On2018-04-27