Incidental Mutation 'R6348:Cnbd1'
ID514435
Institutional Source Beutler Lab
Gene Symbol Cnbd1
Ensembl Gene ENSMUSG00000073991
Gene Namecyclic nucleotide binding domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6348 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location18860454-19122526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18860462 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 428 (D428G)
Ref Sequence ENSEMBL: ENSMUSP00000121576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137780]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133363
Predicted Effect probably damaging
Transcript: ENSMUST00000137780
AA Change: D428G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121576
Gene: ENSMUSG00000073991
AA Change: D428G

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Blast:cNMP 166 225 6e-6 BLAST
SCOP:d1cx4a1 296 430 3e-13 SMART
Blast:cNMP 318 429 2e-60 BLAST
Meta Mutation Damage Score 0.3009 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,414,595 H400Q probably damaging Het
Arhgef16 G T 4: 154,287,083 Q218K probably benign Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atic C T 1: 71,576,698 R468W probably damaging Het
Bfsp2 A T 9: 103,480,072 V52D probably benign Het
Bicd2 A G 13: 49,379,846 H636R probably damaging Het
Chac2 A G 11: 30,977,406 V171A probably damaging Het
Chd9 A G 8: 91,011,275 I1512V possibly damaging Het
Crlf1 T C 8: 70,493,340 S22P probably benign Het
Crybg1 A G 10: 44,003,951 F414L probably damaging Het
Dnah14 A T 1: 181,626,720 D765V possibly damaging Het
Fat3 A G 9: 15,937,991 probably null Het
Gabbr1 A T 17: 37,056,899 M414L possibly damaging Het
Gm960 G C 19: 4,672,078 P105A probably damaging Het
Grip2 A T 6: 91,780,438 D412E probably damaging Het
Herc1 G A 9: 66,487,976 A4198T possibly damaging Het
Hsd3b3 C T 3: 98,755,949 probably null Het
Ifi213 G A 1: 173,590,282 T188I possibly damaging Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kdelc2 G A 9: 53,390,440 V131M probably damaging Het
Klk1b11 T C 7: 43,997,851 probably null Het
Mepce A T 5: 137,785,436 D209E possibly damaging Het
Mtr A C 13: 12,247,954 V111G possibly damaging Het
Olfr1058 T A 2: 86,386,169 Q83L probably benign Het
Olfr826 A T 10: 130,180,297 N194K probably benign Het
Olfr93 A G 17: 37,151,606 V122A probably damaging Het
P2rx1 G A 11: 72,999,322 R3Q probably benign Het
Phc2 G A 4: 128,705,151 G34S probably benign Het
Ppm1a A G 12: 72,790,675 H332R probably benign Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Skiv2l2 T A 13: 112,910,917 H298L possibly damaging Het
Slc2a4 T C 11: 69,945,022 T334A probably benign Het
Slc6a15 T G 10: 103,404,367 V317G probably damaging Het
Speer2 T C 16: 69,858,007 D190G possibly damaging Het
Tbc1d21 G A 9: 58,361,218 A286V probably benign Het
Tmem210 T C 2: 25,288,784 S82P probably benign Het
Zbtb26 C T 2: 37,435,675 V450M probably benign Het
Other mutations in Cnbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Cnbd1 APN 4 18906988 splice site probably benign
IGL01101:Cnbd1 APN 4 18907098 missense probably benign 0.30
IGL01365:Cnbd1 APN 4 18860576 missense probably damaging 1.00
IGL01646:Cnbd1 APN 4 18895141 nonsense probably null
IGL02106:Cnbd1 APN 4 18894993 missense possibly damaging 0.55
IGL02218:Cnbd1 APN 4 18887739 missense probably benign 0.00
IGL02335:Cnbd1 APN 4 19055095 missense possibly damaging 0.87
IGL02380:Cnbd1 APN 4 18887748 critical splice acceptor site probably null
IGL02380:Cnbd1 APN 4 18887749 critical splice acceptor site probably null
IGL02404:Cnbd1 APN 4 18895047 missense possibly damaging 0.64
IGL03293:Cnbd1 APN 4 18860565 missense possibly damaging 0.65
IGL03301:Cnbd1 APN 4 19055039 missense probably benign 0.00
IGL03342:Cnbd1 APN 4 19098264 splice site probably benign
IGL03392:Cnbd1 APN 4 18862111 missense probably damaging 1.00
R0062:Cnbd1 UTSW 4 18860504 missense possibly damaging 0.65
R0062:Cnbd1 UTSW 4 18860504 missense possibly damaging 0.65
R0195:Cnbd1 UTSW 4 18906988 splice site probably benign
R0462:Cnbd1 UTSW 4 18895044 missense probably benign 0.01
R0909:Cnbd1 UTSW 4 19122444 missense probably benign
R1435:Cnbd1 UTSW 4 18907026 missense probably benign 0.00
R1995:Cnbd1 UTSW 4 19055112 missense possibly damaging 0.55
R2495:Cnbd1 UTSW 4 18860579 missense probably damaging 1.00
R3974:Cnbd1 UTSW 4 18887693 missense probably benign 0.00
R4083:Cnbd1 UTSW 4 18886042 missense possibly damaging 0.88
R4494:Cnbd1 UTSW 4 19098150 missense probably benign 0.34
R4558:Cnbd1 UTSW 4 19055095 missense possibly damaging 0.87
R4833:Cnbd1 UTSW 4 18862120 missense probably damaging 0.97
R5326:Cnbd1 UTSW 4 18860517 missense possibly damaging 0.67
R5542:Cnbd1 UTSW 4 18860517 missense possibly damaging 0.67
R5930:Cnbd1 UTSW 4 18886119 missense probably benign 0.14
R5958:Cnbd1 UTSW 4 18862056 missense probably benign 0.31
R6064:Cnbd1 UTSW 4 18895084 missense probably benign 0.14
R6250:Cnbd1 UTSW 4 19098255 missense probably benign 0.00
R7027:Cnbd1 UTSW 4 18862063 missense probably benign 0.01
R7905:Cnbd1 UTSW 4 18907100 missense possibly damaging 0.81
R7988:Cnbd1 UTSW 4 18907100 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GGGGTGCATCTTTCTACTACATATC -3'
(R):5'- AGCCAGAAAGTCTATGAATTGCTC -3'

Sequencing Primer
(F):5'- GCATGAATCCACACTCACT -3'
(R):5'- AGAAAGTCTATGAATTGCTCAGTTTC -3'
Posted On2018-04-27