Incidental Mutation 'R6381:Nab2'
ID 515323
Institutional Source Beutler Lab
Gene Symbol Nab2
Ensembl Gene ENSMUSG00000025402
Gene Name Ngfi-A binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6381 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 127660918-127668568 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127664351 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 291 (K291E)
Ref Sequence ENSEMBL: ENSMUSP00000096761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026469] [ENSMUST00000092074] [ENSMUST00000099157] [ENSMUST00000118728] [ENSMUST00000128780] [ENSMUST00000129252]
AlphaFold Q61127
Predicted Effect probably damaging
Transcript: ENSMUST00000026469
AA Change: K291E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026469
Gene: ENSMUSG00000025402
AA Change: K291E

DomainStartEndE-ValueType
Pfam:NCD1 36 114 1.2e-44 PFAM
Pfam:NCD2 230 364 3.2e-59 PFAM
low complexity region 393 406 N/A INTRINSIC
low complexity region 431 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092074
SMART Domains Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147

DomainStartEndE-ValueType
STAT_int 2 116 2.76e-31 SMART
Pfam:STAT_bind 273 526 4.4e-87 PFAM
SH2 540 622 1.33e-5 SMART
Pfam:STAT6_C 655 837 1.1e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099157
AA Change: K291E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096761
Gene: ENSMUSG00000025402
AA Change: K291E

DomainStartEndE-ValueType
Pfam:NCD1 34 115 4.4e-51 PFAM
Pfam:NCD2 199 366 3.6e-74 PFAM
low complexity region 393 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118728
SMART Domains Protein: ENSMUSP00000113473
Gene: ENSMUSG00000040195

DomainStartEndE-ValueType
Pfam:DUF2215 100 348 7.2e-105 PFAM
low complexity region 367 377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124388
Predicted Effect probably benign
Transcript: ENSMUST00000128780
SMART Domains Protein: ENSMUSP00000121737
Gene: ENSMUSG00000025402

DomainStartEndE-ValueType
Pfam:NCD1 1 66 3.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145470
Meta Mutation Damage Score 0.4652 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of NGFI-A binding (NAB) proteins, which function in the nucleus to repress transcription induced by some members of the EGR (early growth response) family of transactivators. NAB proteins can homo- or hetero-multimerize with other EGR or NAB proteins through a conserved N-terminal domain, and repress transcription through two partially redundant C-terminal domains. Transcriptional repression by the encoded protein is mediated in part by interactions with the nucleosome remodeling and deactylase (NuRD) complex. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal myelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,717 M365L probably damaging Het
5330417C22Rik T C 3: 108,481,814 K222E possibly damaging Het
Aars2 A G 17: 45,518,545 E786G probably benign Het
Adamts12 G T 15: 11,256,994 V478F possibly damaging Het
Akr1c21 T A 13: 4,574,184 D12E probably damaging Het
Aplf A T 6: 87,658,977 M118K probably damaging Het
Apobec1 A G 6: 122,578,931 L189P probably damaging Het
BC061237 A G 14: 44,504,256 Q152R possibly damaging Het
Bche A G 3: 73,701,799 I98T probably benign Het
Cc2d2a G T 5: 43,715,776 R983L possibly damaging Het
Ccnd3 T C 17: 47,505,224 probably benign Het
Cd74 G T 18: 60,811,363 C215F probably damaging Het
Cep97 C T 16: 55,922,171 A138T probably damaging Het
Ces1e T A 8: 93,217,578 N204I probably damaging Het
Dicer1 T C 12: 104,696,462 D1620G probably benign Het
Dnah17 A G 11: 118,129,185 V12A probably benign Het
Dstyk T A 1: 132,456,765 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gm10570 G T 4: 130,308,228 probably benign Het
Gm7145 C T 1: 117,985,939 Q184* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gtse1 G A 15: 85,862,148 R55H probably benign Het
Hdac4 G T 1: 91,984,525 Q381K possibly damaging Het
Ifit3b T C 19: 34,612,471 I349T probably benign Het
Inpp5a A T 7: 139,400,673 D9V probably benign Het
Irs1 T C 1: 82,287,684 N937S possibly damaging Het
Kcna4 T C 2: 107,294,972 M17T probably benign Het
Lipa T A 19: 34,524,746 M33L probably benign Het
March6 G T 15: 31,467,692 Q790K probably benign Het
Mccc1 G A 3: 35,976,727 P397S probably benign Het
Mrgprb2 T C 7: 48,552,390 I196V probably benign Het
Myh15 T A 16: 49,101,481 S463R probably damaging Het
Neto2 T C 8: 85,642,509 T294A probably damaging Het
Nkx1-1 T C 5: 33,433,976 M1V probably null Het
Olfr90 C T 17: 37,086,085 V27I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Psmd2 A G 16: 20,655,273 E242G probably benign Het
Rnase12 A C 14: 51,057,094 Y43D probably damaging Het
Rpl18 T A 7: 45,719,592 F58I probably damaging Het
Ryr1 T G 7: 29,075,257 M2313L possibly damaging Het
Scn4a G T 11: 106,320,311 Q1627K probably damaging Het
Scnn1g A G 7: 121,767,499 S640G probably benign Het
Sdccag3 A G 2: 26,385,081 probably null Het
Sdr9c7 T A 10: 127,903,673 M219K probably benign Het
Soat1 A T 1: 156,435,803 M392K probably damaging Het
Spata18 G T 5: 73,675,216 K337N probably damaging Het
Supt16 A G 14: 52,179,546 V325A probably benign Het
Syt2 A G 1: 134,746,850 E342G probably damaging Het
Tars2 A T 3: 95,754,487 L37* probably null Het
Tep1 T C 14: 50,845,431 D1040G probably damaging Het
Tmc8 A T 11: 117,791,600 S613C probably null Het
Top3a C T 11: 60,744,023 C660Y probably damaging Het
Tpsg1 C T 17: 25,372,569 R48C probably damaging Het
Vmn2r57 T C 7: 41,428,818 N72S probably benign Het
Whrn G A 4: 63,472,684 T269I probably benign Het
Zfp759 T A 13: 67,138,905 Y173* probably null Het
Other mutations in Nab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Nab2 APN 10 127665109 missense probably damaging 1.00
IGL01415:Nab2 APN 10 127665103 missense probably damaging 1.00
IGL02248:Nab2 APN 10 127663240 missense probably benign 0.31
IGL03080:Nab2 APN 10 127664794 missense possibly damaging 0.56
IGL03084:Nab2 APN 10 127664477 missense probably damaging 1.00
katie UTSW 10 127664338 missense probably damaging 1.00
schneider UTSW 10 127666548 intron probably benign
R0381:Nab2 UTSW 10 127665067 missense probably damaging 1.00
R1074:Nab2 UTSW 10 127663255 nonsense probably null
R1535:Nab2 UTSW 10 127665047 missense probably damaging 0.99
R4214:Nab2 UTSW 10 127665048 nonsense probably null
R4742:Nab2 UTSW 10 127662827 missense probably benign 0.02
R5590:Nab2 UTSW 10 127664657 missense probably damaging 0.98
R5603:Nab2 UTSW 10 127665121 start codon destroyed probably null 0.96
R5776:Nab2 UTSW 10 127664329 missense probably damaging 0.99
R6018:Nab2 UTSW 10 127664924 nonsense probably null
R6610:Nab2 UTSW 10 127664338 missense probably damaging 1.00
R7025:Nab2 UTSW 10 127666508 intron probably benign
R8220:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8221:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8222:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8223:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8277:Nab2 UTSW 10 127665299 intron probably benign
R8293:Nab2 UTSW 10 127666397 missense possibly damaging 0.86
R8766:Nab2 UTSW 10 127666548 intron probably benign
R9375:Nab2 UTSW 10 127664711 missense probably damaging 1.00
RF005:Nab2 UTSW 10 127664364 missense probably benign 0.04
RF024:Nab2 UTSW 10 127664364 missense probably benign 0.04
Z1176:Nab2 UTSW 10 127663132 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGTGGGGACAGTCATACAGAG -3'
(R):5'- AATCTGATGTTGGAGCAGGG -3'

Sequencing Primer
(F):5'- CAGTCATACAGAGGTGGAAGAC -3'
(R):5'- AGGAGTCTCTGAAGGGCCTG -3'
Posted On 2018-05-04