Mutagenetix > Incidental Mutation

Incidental Mutation 'R6381:Nab2'

515323

Institutional Source

Beutler Lab

Gene Symbol

Nab2

Ensembl Gene

ENSMUSG00000025402

Gene Name

Ngfi-A binding protein 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6381 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127660918-127668568 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 127664351 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 291 (K291E)

Ref Sequence

ENSEMBL: ENSMUSP00000096761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026469] [ENSMUST00000092074] [ENSMUST00000099157] [ENSMUST00000118728] [ENSMUST00000128780] [ENSMUST00000129252]

AlphaFold

Q61127

Predicted Effect

probably damaging
Transcript: ENSMUST00000026469
AA Change: K291E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000026469
Gene: ENSMUSG00000025402
AA Change: K291E

Domain	Start	End	E-Value	Type
Pfam:NCD1	36	114	1.2e-44	PFAM
Pfam:NCD2	230	364	3.2e-59	PFAM
low complexity region	393	406	N/A	INTRINSIC
low complexity region	431	446	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000092074

SMART Domains

Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147

Domain	Start	End	E-Value	Type
STAT_int	2	116	2.76e-31	SMART
Pfam:STAT_bind	273	526	4.4e-87	PFAM
SH2	540	622	1.33e-5	SMART
Pfam:STAT6_C	655	837	1.1e-94	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000099157
AA Change: K291E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096761
Gene: ENSMUSG00000025402
AA Change: K291E

Domain	Start	End	E-Value	Type
Pfam:NCD1	34	115	4.4e-51	PFAM
Pfam:NCD2	199	366	3.6e-74	PFAM
low complexity region	393	406	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118728

SMART Domains

Protein: ENSMUSP00000113473
Gene: ENSMUSG00000040195

Domain	Start	End	E-Value	Type
Pfam:DUF2215	100	348	7.2e-105	PFAM
low complexity region	367	377	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124388

Predicted Effect

probably benign
Transcript: ENSMUST00000128780

SMART Domains

Protein: ENSMUSP00000121737
Gene: ENSMUSG00000025402

Domain	Start	End	E-Value	Type
Pfam:NCD1	1	66	3.4e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129252

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133270

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133505

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145470

Meta Mutation Damage Score

0.4652

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of NGFI-A binding (NAB) proteins, which function in the nucleus to repress transcription induced by some members of the EGR (early growth response) family of transactivators. NAB proteins can homo- or hetero-multimerize with other EGR or NAB proteins through a conserved N-terminal domain, and repress transcription through two partially redundant C-terminal domains. Transcriptional repression by the encoded protein is mediated in part by interactions with the nucleosome remodeling and deactylase (NuRD) complex. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal myelination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	A	18: 70,467,717	M365L	probably damaging	Het
5330417C22Rik	T	C	3: 108,481,814	K222E	possibly damaging	Het
Aars2	A	G	17: 45,518,545	E786G	probably benign	Het
Adamts12	G	T	15: 11,256,994	V478F	possibly damaging	Het
Akr1c21	T	A	13: 4,574,184	D12E	probably damaging	Het
Aplf	A	T	6: 87,658,977	M118K	probably damaging	Het
Apobec1	A	G	6: 122,578,931	L189P	probably damaging	Het
BC061237	A	G	14: 44,504,256	Q152R	possibly damaging	Het
Bche	A	G	3: 73,701,799	I98T	probably benign	Het
Cc2d2a	G	T	5: 43,715,776	R983L	possibly damaging	Het
Ccnd3	T	C	17: 47,505,224		probably benign	Het
Cd74	G	T	18: 60,811,363	C215F	probably damaging	Het
Cep97	C	T	16: 55,922,171	A138T	probably damaging	Het
Ces1e	T	A	8: 93,217,578	N204I	probably damaging	Het
Dicer1	T	C	12: 104,696,462	D1620G	probably benign	Het
Dnah17	A	G	11: 118,129,185	V12A	probably benign	Het
Dstyk	T	A	1: 132,456,765		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Gm10570	G	T	4: 130,308,228		probably benign	Het
Gm7145	C	T	1: 117,985,939	Q184*	probably null	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gtse1	G	A	15: 85,862,148	R55H	probably benign	Het
Hdac4	G	T	1: 91,984,525	Q381K	possibly damaging	Het
Ifit3b	T	C	19: 34,612,471	I349T	probably benign	Het
Inpp5a	A	T	7: 139,400,673	D9V	probably benign	Het
Irs1	T	C	1: 82,287,684	N937S	possibly damaging	Het
Kcna4	T	C	2: 107,294,972	M17T	probably benign	Het
Lipa	T	A	19: 34,524,746	M33L	probably benign	Het
March6	G	T	15: 31,467,692	Q790K	probably benign	Het
Mccc1	G	A	3: 35,976,727	P397S	probably benign	Het
Mrgprb2	T	C	7: 48,552,390	I196V	probably benign	Het
Myh15	T	A	16: 49,101,481	S463R	probably damaging	Het
Neto2	T	C	8: 85,642,509	T294A	probably damaging	Het
Nkx1-1	T	C	5: 33,433,976	M1V	probably null	Het
Olfr90	C	T	17: 37,086,085	V27I	probably benign	Het
Pla2g4c	C	T	7: 13,344,008	T357I	probably benign	Het
Psmd2	A	G	16: 20,655,273	E242G	probably benign	Het
Rnase12	A	C	14: 51,057,094	Y43D	probably damaging	Het
Rpl18	T	A	7: 45,719,592	F58I	probably damaging	Het
Ryr1	T	G	7: 29,075,257	M2313L	possibly damaging	Het
Scn4a	G	T	11: 106,320,311	Q1627K	probably damaging	Het
Scnn1g	A	G	7: 121,767,499	S640G	probably benign	Het
Sdccag3	A	G	2: 26,385,081		probably null	Het
Sdr9c7	T	A	10: 127,903,673	M219K	probably benign	Het
Soat1	A	T	1: 156,435,803	M392K	probably damaging	Het
Spata18	G	T	5: 73,675,216	K337N	probably damaging	Het
Supt16	A	G	14: 52,179,546	V325A	probably benign	Het
Syt2	A	G	1: 134,746,850	E342G	probably damaging	Het
Tars2	A	T	3: 95,754,487	L37*	probably null	Het
Tep1	T	C	14: 50,845,431	D1040G	probably damaging	Het
Tmc8	A	T	11: 117,791,600	S613C	probably null	Het
Top3a	C	T	11: 60,744,023	C660Y	probably damaging	Het
Tpsg1	C	T	17: 25,372,569	R48C	probably damaging	Het
Vmn2r57	T	C	7: 41,428,818	N72S	probably benign	Het
Whrn	G	A	4: 63,472,684	T269I	probably benign	Het
Zfp759	T	A	13: 67,138,905	Y173*	probably null	Het

Other mutations in Nab2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01288:Nab2	APN	10	127665109	missense	probably damaging	1.00
IGL01415:Nab2	APN	10	127665103	missense	probably damaging	1.00
IGL02248:Nab2	APN	10	127663240	missense	probably benign	0.31
IGL03080:Nab2	APN	10	127664794	missense	possibly damaging	0.56
IGL03084:Nab2	APN	10	127664477	missense	probably damaging	1.00
katie	UTSW	10	127664338	missense	probably damaging	1.00
schneider	UTSW	10	127666548	intron	probably benign
R0381:Nab2	UTSW	10	127665067	missense	probably damaging	1.00
R1074:Nab2	UTSW	10	127663255	nonsense	probably null
R1535:Nab2	UTSW	10	127665047	missense	probably damaging	0.99
R4214:Nab2	UTSW	10	127665048	nonsense	probably null
R4742:Nab2	UTSW	10	127662827	missense	probably benign	0.02
R5590:Nab2	UTSW	10	127664657	missense	probably damaging	0.98
R5603:Nab2	UTSW	10	127665121	start codon destroyed	probably null	0.96
R5776:Nab2	UTSW	10	127664329	missense	probably damaging	0.99
R6018:Nab2	UTSW	10	127664924	nonsense	probably null
R6610:Nab2	UTSW	10	127664338	missense	probably damaging	1.00
R7025:Nab2	UTSW	10	127666508	intron	probably benign
R8220:Nab2	UTSW	10	127662776	missense	probably benign	0.03
R8221:Nab2	UTSW	10	127662776	missense	probably benign	0.03
R8222:Nab2	UTSW	10	127662776	missense	probably benign	0.03
R8223:Nab2	UTSW	10	127662776	missense	probably benign	0.03
R8277:Nab2	UTSW	10	127665299	intron	probably benign
R8293:Nab2	UTSW	10	127666397	missense	possibly damaging	0.86
R8766:Nab2	UTSW	10	127666548	intron	probably benign
R9375:Nab2	UTSW	10	127664711	missense	probably damaging	1.00
RF005:Nab2	UTSW	10	127664364	missense	probably benign	0.04
RF024:Nab2	UTSW	10	127664364	missense	probably benign	0.04
Z1176:Nab2	UTSW	10	127663132	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCGTGGGGACAGTCATACAGAG -3'
(R):5'- AATCTGATGTTGGAGCAGGG -3'

Sequencing Primer
(F):5'- CAGTCATACAGAGGTGGAAGAC -3'
(R):5'- AGGAGTCTCTGAAGGGCCTG -3'

Posted On

2018-05-04