Incidental Mutation 'R6402:Creld2'
ID516204
Institutional Source Beutler Lab
Gene Symbol Creld2
Ensembl Gene ENSMUSG00000023272
Gene Namecysteine-rich with EGF-like domains 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6402 (G1)
Quality Score210.009
Status Not validated
Chromosome15
Chromosomal Location88819646-88826683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88823141 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 221 (R221C)
Ref Sequence ENSEMBL: ENSMUSP00000024042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024042] [ENSMUST00000043087] [ENSMUST00000159328] [ENSMUST00000162183]
Predicted Effect probably damaging
Transcript: ENSMUST00000024042
AA Change: R221C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024042
Gene: ENSMUSG00000023272
AA Change: R221C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF3456 28 86 1.3e-7 PFAM
low complexity region 90 100 N/A INTRINSIC
EGF 137 176 3.76e-1 SMART
FU 191 238 1.2e-7 SMART
EGF_like 228 273 1.76e-3 SMART
FU 251 298 5.08e-6 SMART
EGF_CA 288 329 3.17e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043087
SMART Domains Protein: ENSMUSP00000043480
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 267 4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159328
SMART Domains Protein: ENSMUSP00000125534
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 169 6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162183
SMART Domains Protein: ENSMUSP00000123935
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 406 3.3e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Creld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0510:Creld2 UTSW 15 88819956 missense probably damaging 1.00
R1137:Creld2 UTSW 15 88820631 nonsense probably null
R1163:Creld2 UTSW 15 88820631 nonsense probably null
R1164:Creld2 UTSW 15 88820631 nonsense probably null
R1206:Creld2 UTSW 15 88820631 nonsense probably null
R1207:Creld2 UTSW 15 88820631 nonsense probably null
R1207:Creld2 UTSW 15 88820631 nonsense probably null
R1457:Creld2 UTSW 15 88823753 missense probably damaging 1.00
R1475:Creld2 UTSW 15 88820631 nonsense probably null
R1915:Creld2 UTSW 15 88820631 nonsense probably null
R2105:Creld2 UTSW 15 88820631 nonsense probably null
R4297:Creld2 UTSW 15 88823753 missense probably damaging 1.00
R5843:Creld2 UTSW 15 88826429 missense probably damaging 1.00
R6066:Creld2 UTSW 15 88823766 missense possibly damaging 0.95
R6454:Creld2 UTSW 15 88823071 nonsense probably null
R6543:Creld2 UTSW 15 88825278 missense probably benign 0.00
R6808:Creld2 UTSW 15 88825210 missense probably damaging 1.00
R6912:Creld2 UTSW 15 88819997 missense probably damaging 1.00
R7342:Creld2 UTSW 15 88826407 missense probably benign 0.03
R8058:Creld2 UTSW 15 88826429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGAGTTAAGTGCTGCTGTTTTC -3'
(R):5'- ACATGCCGGCCATAAGAGTG -3'

Sequencing Primer
(F):5'- TTCCTGCCAATCTTAAAAATCCTC -3'
(R):5'- TGGCCTTCCACAGCCCC -3'
Posted On2018-05-04