Incidental Mutation 'R6483:Naglu'
ID517223
Institutional Source Beutler Lab
Gene Symbol Naglu
Ensembl Gene ENSMUSG00000001751
Gene Namealpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101070012-101077672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101071181 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 160 (I160T)
Ref Sequence ENSEMBL: ENSMUSP00000001802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001802]
Predicted Effect probably damaging
Transcript: ENSMUST00000001802
AA Change: I160T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001802
Gene: ENSMUSG00000001751
AA Change: I160T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:NAGLU_N 28 114 4.8e-24 PFAM
Pfam:NAGLU 128 463 8.2e-150 PFAM
Pfam:NAGLU_C 471 731 4.5e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140735
Meta Mutation Damage Score 0.9623 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that degrades heparan sulfate by hydrolysis of terminal N-acetyl-D-glucosamine residues in N-acetyl-alpha-D-glucosaminides. Defects in this gene are the cause of mucopolysaccharidosis type IIIB (MPS-IIIB), also known as Sanfilippo syndrome B. This disease is characterized by the lysosomal accumulation and urinary excretion of heparan sulfate. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced open field activity, massive accumulation of heparan sulfate in kidney and liver, elevated gangliosides in brain, and presence of vacuoles in macrophages, epithelial cells, and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Naglu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Naglu APN 11 101076952 missense possibly damaging 0.84
IGL01025:Naglu APN 11 101073947 missense probably benign 0.01
IGL01775:Naglu APN 11 101074095 missense probably damaging 1.00
tulane UTSW 11 101070332 missense probably benign 0.01
R0044:Naglu UTSW 11 101071217 missense probably damaging 0.99
R0281:Naglu UTSW 11 101074027 missense probably damaging 0.99
R0395:Naglu UTSW 11 101074107 unclassified probably benign
R1624:Naglu UTSW 11 101076525 missense probably damaging 1.00
R1739:Naglu UTSW 11 101076403 missense possibly damaging 0.88
R2092:Naglu UTSW 11 101076720 missense possibly damaging 0.94
R4118:Naglu UTSW 11 101074082 missense probably benign 0.39
R4582:Naglu UTSW 11 101071929 missense probably damaging 0.97
R4792:Naglu UTSW 11 101071106 missense probably damaging 1.00
R4834:Naglu UTSW 11 101076988 missense probably benign
R5232:Naglu UTSW 11 101070150 missense probably benign 0.02
R5387:Naglu UTSW 11 101076724 missense probably damaging 1.00
R6463:Naglu UTSW 11 101077351 unclassified probably null
R7141:Naglu UTSW 11 101072230 missense probably benign 0.10
R7187:Naglu UTSW 11 101070332 missense probably benign 0.01
R7232:Naglu UTSW 11 101076426 missense probably damaging 1.00
R7478:Naglu UTSW 11 101071899 missense probably damaging 1.00
R7828:Naglu UTSW 11 101076610 missense probably damaging 0.99
R7829:Naglu UTSW 11 101076610 missense probably damaging 0.99
X0023:Naglu UTSW 11 101072014 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCTGAAGTGTTCCAGAGGGG -3'
(R):5'- TCAAACCACGGAGAGTCTCTG -3'

Sequencing Primer
(F):5'- GTGAGTGAGGCATCCCATATGTCC -3'
(R):5'- ACTTAAGCTAGGGTCATCCGG -3'
Posted On2018-05-21