Incidental Mutation 'R6494:Rbck1'
ID 522920
Institutional Source Beutler Lab
Gene Symbol Rbck1
Ensembl Gene ENSMUSG00000027466
Gene Name RanBP-type and C3HC4-type zinc finger containing 1
Synonyms HOIL-1, HOIL-1L, Ubce7ip3
MMRRC Submission
Accession Numbers

Genbank: NM_001083921; MGI: 1344372

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6494 (G1)
Quality Score 204.009
Status Validated
Chromosome 2
Chromosomal Location 152316334-152332653 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 152330966 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 54 (D54G)
Ref Sequence ENSEMBL: ENSMUSP00000105473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028964] [ENSMUST00000109847]
AlphaFold Q9WUB0
Predicted Effect possibly damaging
Transcript: ENSMUST00000028964
AA Change: D54G

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028964
Gene: ENSMUSG00000027466
AA Change: D54G

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Pfam:IBR 346 409 1.5e-9 PFAM
Pfam:IBR 422 483 2.5e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109847
AA Change: D54G

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105473
Gene: ENSMUSG00000027466
AA Change: D54G

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Blast:IBR 427 507 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131889
Meta Mutation Damage Score 0.6432 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to mouse UIP28/UbcM4 interacting protein. Alternative splicing has been observed at this locus, resulting in distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased TNF-induced hepatocyte apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Rbck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Rbck1 APN 2 152318395 missense probably damaging 0.98
IGL00765:Rbck1 APN 2 152330954 splice site probably benign
IGL01647:Rbck1 APN 2 152323232 missense probably damaging 1.00
IGL01945:Rbck1 APN 2 152318316 missense probably damaging 1.00
IGL02141:Rbck1 APN 2 152318374 missense possibly damaging 0.56
IGL02573:Rbck1 APN 2 152322167 missense possibly damaging 0.90
IGL02950:Rbck1 APN 2 152331077 missense possibly damaging 0.95
green_fire UTSW 2 152323174 nonsense probably null
iron_throne UTSW 2 152318451 missense probably benign 0.45
Viserion UTSW 2 152330966 missense possibly damaging 0.87
westeros UTSW 2 152318733 nonsense probably null
A4554:Rbck1 UTSW 2 152319172 missense probably damaging 1.00
R0532:Rbck1 UTSW 2 152324330 missense probably damaging 0.99
R1426:Rbck1 UTSW 2 152327241 unclassified probably benign
R1598:Rbck1 UTSW 2 152323170 critical splice donor site probably null
R1666:Rbck1 UTSW 2 152316899 missense probably damaging 0.99
R1668:Rbck1 UTSW 2 152316899 missense probably damaging 0.99
R1889:Rbck1 UTSW 2 152318356 missense probably damaging 0.99
R4572:Rbck1 UTSW 2 152318733 nonsense probably null
R4592:Rbck1 UTSW 2 152318733 nonsense probably null
R5077:Rbck1 UTSW 2 152318451 missense probably benign 0.45
R6049:Rbck1 UTSW 2 152323174 nonsense probably null
R7530:Rbck1 UTSW 2 152324292 missense possibly damaging 0.54
R7878:Rbck1 UTSW 2 152318410 missense probably damaging 0.97
R8346:Rbck1 UTSW 2 152318780 missense probably damaging 1.00
R8871:Rbck1 UTSW 2 152322176 missense possibly damaging 0.92
R9353:Rbck1 UTSW 2 152319225 missense probably damaging 1.00
Z1177:Rbck1 UTSW 2 152324298 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGTGCAGGGTCCTCTTAAAAG -3'
(R):5'- AACTGATGCTAACCTGCTTGC -3'

Sequencing Primer
(F):5'- GCCTACCCCATAGCTCACAG -3'
(R):5'- GATGCTAACCTGCTTGCTCTCTG -3'
Posted On 2018-06-06