Incidental Mutation 'R6616:Gtpbp4'
ID524085
Institutional Source Beutler Lab
Gene Symbol Gtpbp4
Ensembl Gene ENSMUSG00000021149
Gene NameGTP binding protein 4
SynonymsNog1, 2610028C09Rik, Crfg
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location8966331-8996083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8989105 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 201 (T201I)
Ref Sequence ENSEMBL: ENSMUSP00000152412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021574] [ENSMUST00000222098]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021574
AA Change: T144I

PolyPhen 2 Score 0.604 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021574
Gene: ENSMUSG00000021149
AA Change: T144I

DomainStartEndE-ValueType
Pfam:FeoB_N 169 335 4.7e-13 PFAM
Pfam:MMR_HSR1 170 290 1.7e-18 PFAM
Pfam:NOG1 235 292 1.3e-29 PFAM
Pfam:NOGCT 395 446 1.4e-24 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 467 479 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
low complexity region 560 575 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221534
Predicted Effect possibly damaging
Transcript: ENSMUST00000222098
AA Change: T201I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223218
Meta Mutation Damage Score 0.4934 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GTP-binding proteins are GTPases and function as molecular switches that can flip between two states: active, when GTP is bound, and inactive, when GDP is bound. 'Active' in this context usually means that the molecule acts as a signal to trigger other events in the cell. When an extracellular ligand binds to a G-protein-linked receptor, the receptor changes its conformation and switches on the trimeric G proteins that associate with it by causing them to eject their GDP and replace it with GTP. The switch is turned off when the G protein hydrolyzes its own bound GTP, converting it back to GDP. But before that occurs, the active protein has an opportunity to diffuse away from the receptor and deliver its message for a prolonged period to its downstream target. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Gtpbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gtpbp4 APN 13 8977272 missense probably benign
IGL01319:Gtpbp4 APN 13 8985260 missense probably benign 0.05
IGL02108:Gtpbp4 APN 13 8985213 missense probably benign 0.20
IGL02116:Gtpbp4 APN 13 8992736 missense probably damaging 1.00
IGL02406:Gtpbp4 APN 13 8991750 missense possibly damaging 0.81
Atretic UTSW 13 8990737 nonsense probably null
enervated UTSW 13 8989105 missense possibly damaging 0.93
PIT4576001:Gtpbp4 UTSW 13 8991727 missense probably damaging 0.99
R0183:Gtpbp4 UTSW 13 8974961 missense probably benign 0.05
R0571:Gtpbp4 UTSW 13 8990686 splice site probably benign
R1420:Gtpbp4 UTSW 13 8973262 missense probably benign 0.00
R1641:Gtpbp4 UTSW 13 8973249 missense probably benign 0.22
R1840:Gtpbp4 UTSW 13 8979464 missense probably benign 0.00
R1967:Gtpbp4 UTSW 13 8977304 missense probably benign 0.01
R2883:Gtpbp4 UTSW 13 8990723 missense possibly damaging 0.86
R3862:Gtpbp4 UTSW 13 8990798 missense probably damaging 0.99
R4524:Gtpbp4 UTSW 13 8974294 missense probably benign 0.02
R4963:Gtpbp4 UTSW 13 8985217 missense probably damaging 1.00
R5009:Gtpbp4 UTSW 13 8989066 missense probably benign 0.05
R5555:Gtpbp4 UTSW 13 8979427 critical splice donor site probably null
R5749:Gtpbp4 UTSW 13 8995947 critical splice donor site probably null
R5860:Gtpbp4 UTSW 13 8973160 missense probably benign 0.00
R6449:Gtpbp4 UTSW 13 8990737 nonsense probably null
R7261:Gtpbp4 UTSW 13 8987918 missense probably benign 0.12
R7829:Gtpbp4 UTSW 13 8985330 splice site probably null
R7999:Gtpbp4 UTSW 13 8987286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGGAGATACACTTCAGCTC -3'
(R):5'- GACTGTGAGCCTGTTACCTTC -3'

Sequencing Primer
(F):5'- ATCATTCAAGTTGCCAGGCG -3'
(R):5'- GCATCAGCAGCCTGTACAG -3'
Posted On2018-06-22