Mutagenetix > Incidental Mutation

Incidental Mutation 'R6595:Cpsf1'

524893

Institutional Source

Beutler Lab

Gene Symbol

Cpsf1

Ensembl Gene

ENSMUSG00000034022

Gene Name

cleavage and polyadenylation specific factor 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R6595 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76595803-76607591 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76602510 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 275 (I275M)

Ref Sequence

ENSEMBL: ENSMUSP00000155308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000230157] [ENSMUST00000231042]

AlphaFold

Q9EPU4

Predicted Effect

probably damaging
Transcript: ENSMUST00000071898
AA Change: I275M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: I275M

Domain	Start	End	E-Value	Type
Pfam:MMS1_N	92	684	7.2e-42	PFAM
low complexity region	902	910	N/A	INTRINSIC
Pfam:CPSF_A	1071	1407	4.9e-94	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229015

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229269

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229367

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229437

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229447

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229797

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229798

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229982

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230149

Predicted Effect

probably damaging
Transcript: ENSMUST00000230157
AA Change: I275M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230822

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231037

Predicted Effect

probably benign
Transcript: ENSMUST00000231042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231191

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,801,858	D217V	possibly damaging	Het
Abca15	A	T	7: 120,394,487	Y1310F	probably benign	Het
Ankrd54	A	G	15: 79,057,985	F148L	probably damaging	Het
Bag4	C	T	8: 25,769,500	D224N	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Camk2b	A	T	11: 5,992,856	H126Q	probably damaging	Het
Camsap3	G	T	8: 3,604,186	V608L	probably damaging	Het
Camsap3	A	T	8: 3,608,742	M796L	probably damaging	Het
Cdh19	T	C	1: 110,925,787	D308G	probably benign	Het
Cuta	A	G	17: 26,938,882		probably null	Het
Dclk2	A	G	3: 86,792,067		probably benign	Het
Dst	T	G	1: 34,250,680	L784R	probably damaging	Het
Fbn1	T	C	2: 125,342,830	M1681V	possibly damaging	Het
Fbxo9	A	T	9: 78,087,212	D274E	probably damaging	Het
Frem2	T	A	3: 53,549,784	D2049V	probably damaging	Het
Fscn3	T	C	6: 28,430,175	Y115H	probably damaging	Het
Glp2r	G	T	11: 67,764,777	D46E	probably benign	Het
Gm13103	T	C	4: 143,852,756	C304R	probably damaging	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Irx5	A	G	8: 92,359,619	Y110C	probably damaging	Het
Kdm5d	T	C	Y: 939,829	S994P	probably benign	Homo
Klhl2	A	T	8: 64,743,043	C555*	probably null	Het
Krtap4-7	A	T	11: 99,643,734	I101N	unknown	Het
Olfr1308	A	T	2: 111,960,170	V301E	possibly damaging	Het
Olfr60	A	G	7: 140,345,647	L114P	probably damaging	Het
Pcdhb21	T	C	18: 37,515,908	S697P	probably damaging	Het
Rasgrf2	A	T	13: 92,030,853	H237Q	probably damaging	Het
Rnf216	A	T	5: 143,090,657	D157E	probably benign	Het
Rxrg	T	A	1: 167,627,336	F163I	probably damaging	Het
Soat2	T	A	15: 102,160,593	I351N	probably damaging	Het
Srp72	C	T	5: 76,984,200	T242I	probably benign	Het
Svopl	T	C	6: 38,041,067		probably null	Het
Tbc1d2b	G	A	9: 90,226,092	P469S	probably benign	Het
Tbkbp1	G	A	11: 97,138,752		probably benign	Het
Tecta	A	G	9: 42,384,227	V324A	probably damaging	Het
Twnk	T	C	19: 45,010,492	V557A	probably damaging	Het
Vmn2r18	G	A	5: 151,562,424	T535I	probably damaging	Het
Zc3h14	T	A	12: 98,757,026	S85T	probably damaging	Het

Other mutations in Cpsf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Cpsf1	APN	15	76600216	missense	probably benign	0.27
IGL01013:Cpsf1	APN	15	76599297	nonsense	probably null
IGL01599:Cpsf1	APN	15	76596541	missense	probably damaging	1.00
IGL02008:Cpsf1	APN	15	76603091	missense	probably damaging	1.00
IGL02291:Cpsf1	APN	15	76602821	missense	probably damaging	1.00
IGL02901:Cpsf1	APN	15	76599496	nonsense	probably null
IGL02929:Cpsf1	APN	15	76602127	critical splice donor site	probably null
IGL03402:Cpsf1	APN	15	76596003	splice site	probably null
R0005:Cpsf1	UTSW	15	76600680	critical splice donor site	probably null
R0044:Cpsf1	UTSW	15	76599553	missense	probably benign
R0044:Cpsf1	UTSW	15	76599553	missense	probably benign
R0487:Cpsf1	UTSW	15	76597002	missense	probably damaging	1.00
R0510:Cpsf1	UTSW	15	76603657	intron	probably benign
R0630:Cpsf1	UTSW	15	76601971	missense	probably damaging	1.00
R0780:Cpsf1	UTSW	15	76600377	missense	probably benign	0.17
R1617:Cpsf1	UTSW	15	76602370	nonsense	probably null
R1717:Cpsf1	UTSW	15	76602566	missense	possibly damaging	0.77
R1889:Cpsf1	UTSW	15	76602156	missense	probably benign	0.06
R1994:Cpsf1	UTSW	15	76603160	missense	probably benign	0.03
R2168:Cpsf1	UTSW	15	76603737	missense	possibly damaging	0.69
R2359:Cpsf1	UTSW	15	76597673	missense	probably benign	0.02
R2697:Cpsf1	UTSW	15	76599329	missense	probably damaging	1.00
R2847:Cpsf1	UTSW	15	76602851	missense	probably damaging	1.00
R2848:Cpsf1	UTSW	15	76602851	missense	probably damaging	1.00
R3409:Cpsf1	UTSW	15	76601781	nonsense	probably null
R3410:Cpsf1	UTSW	15	76601781	nonsense	probably null
R3815:Cpsf1	UTSW	15	76601149	missense	probably benign	0.22
R4030:Cpsf1	UTSW	15	76601779	missense	possibly damaging	0.96
R4491:Cpsf1	UTSW	15	76597722	missense	possibly damaging	0.85
R4615:Cpsf1	UTSW	15	76596937	missense	possibly damaging	0.88
R5227:Cpsf1	UTSW	15	76598948	missense	probably damaging	1.00
R5353:Cpsf1	UTSW	15	76602571	missense	probably damaging	1.00
R5548:Cpsf1	UTSW	15	76597327	missense	possibly damaging	0.95
R5552:Cpsf1	UTSW	15	76599646	missense	probably benign	0.27
R5746:Cpsf1	UTSW	15	76599837	missense	probably benign	0.01
R6319:Cpsf1	UTSW	15	76596967	missense	probably damaging	1.00
R6360:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6572:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6574:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6576:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6577:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6588:Cpsf1	UTSW	15	76596822	missense	probably damaging	1.00
R6621:Cpsf1	UTSW	15	76603519	missense	probably damaging	1.00
R6880:Cpsf1	UTSW	15	76602539	missense	probably benign	0.06
R6954:Cpsf1	UTSW	15	76599496	missense	probably damaging	1.00
R7100:Cpsf1	UTSW	15	76596114	missense	possibly damaging	0.73
R7255:Cpsf1	UTSW	15	76597543	missense	probably damaging	1.00
R7318:Cpsf1	UTSW	15	76597275	nonsense	probably null
R7371:Cpsf1	UTSW	15	76600575	missense	probably damaging	1.00
R7387:Cpsf1	UTSW	15	76602566	missense	possibly damaging	0.77
R7446:Cpsf1	UTSW	15	76601750	missense	probably benign
R7612:Cpsf1	UTSW	15	76597009	missense	probably benign	0.00
R7739:Cpsf1	UTSW	15	76600311	missense	probably benign	0.00
R7878:Cpsf1	UTSW	15	76600500	missense	probably damaging	1.00
R8334:Cpsf1	UTSW	15	76603587	missense	probably benign	0.26
R8345:Cpsf1	UTSW	15	76601490	missense	probably benign
R8382:Cpsf1	UTSW	15	76600951	missense	probably benign
R8403:Cpsf1	UTSW	15	76600283	missense	probably damaging	0.96
R8968:Cpsf1	UTSW	15	76601969	nonsense	probably null
R8972:Cpsf1	UTSW	15	76597328	missense	probably damaging	1.00
R9257:Cpsf1	UTSW	15	76600792	missense	probably benign
R9627:Cpsf1	UTSW	15	76599888	missense	probably damaging	0.97
R9776:Cpsf1	UTSW	15	76602579	missense	probably damaging	1.00
X0052:Cpsf1	UTSW	15	76596302	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AGGCACATCCCACTTTGAC -3'
(R):5'- AATGTGACTGCCTCTGGGTG -3'

Sequencing Primer
(F):5'- CACTTACGCAATGGGAAAGC -3'
(R):5'- GGTGACCTACCTGCTGCTCTAG -3'

Posted On

2018-06-22