Incidental Mutation 'R6601:Ubr7'
ID525285
Institutional Source Beutler Lab
Gene Symbol Ubr7
Ensembl Gene ENSMUSG00000041712
Gene Nameubiquitin protein ligase E3 component n-recognin 7 (putative)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location102757967-102777707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102761464 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 82 (C82S)
Ref Sequence ENSEMBL: ENSMUSP00000041247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046404] [ENSMUST00000173969] [ENSMUST00000174651] [ENSMUST00000179263] [ENSMUST00000179306]
Predicted Effect probably damaging
Transcript: ENSMUST00000046404
AA Change: C82S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041247
Gene: ENSMUSG00000041712
AA Change: C82S

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:zf-UBR 45 113 2.4e-15 PFAM
PHD 134 186 1.78e-1 SMART
low complexity region 261 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173969
SMART Domains Protein: ENSMUSP00000136425
Gene: ENSMUSG00000091931

DomainStartEndE-ValueType
Pfam:DUF4611 3 96 7.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174651
SMART Domains Protein: ENSMUSP00000133604
Gene: ENSMUSG00000041716

DomainStartEndE-ValueType
Pfam:DUF4611 3 73 8.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179263
SMART Domains Protein: ENSMUSP00000137212
Gene: ENSMUSG00000091931

DomainStartEndE-ValueType
Pfam:DUF4611 3 77 7.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179306
SMART Domains Protein: ENSMUSP00000136193
Gene: ENSMUSG00000098530

DomainStartEndE-ValueType
Pfam:DUF4611 3 77 1.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221771
Meta Mutation Damage Score 0.9680 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a UBR box-containing protein that belongs to the E3 ubiquitin ligase family. The protein also contains a plant homeodomain (PHD) in the C-terminus. In mammals, the encoded protein recognizes N-degrons, the destabilizing N-terminal residues of short-lived proteins, which results in ubiquitinylation, and proteolysis via the proteasome. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Ubr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Ubr7 APN 12 102768276 nonsense probably null
IGL02493:Ubr7 APN 12 102768220 missense probably benign 0.00
IGL02750:Ubr7 APN 12 102771278 missense possibly damaging 0.68
IGL03229:Ubr7 APN 12 102769155 missense probably damaging 1.00
dwindled UTSW 12 102761464 missense probably damaging 1.00
R0519:Ubr7 UTSW 12 102768206 missense probably benign 0.00
R0894:Ubr7 UTSW 12 102769191 missense probably damaging 1.00
R1453:Ubr7 UTSW 12 102769178 missense probably benign 0.00
R1598:Ubr7 UTSW 12 102769894 missense probably damaging 1.00
R2201:Ubr7 UTSW 12 102761505 critical splice donor site probably null
R4731:Ubr7 UTSW 12 102769226 missense probably benign 0.03
R4834:Ubr7 UTSW 12 102761502 missense probably damaging 1.00
R5222:Ubr7 UTSW 12 102775705 missense probably benign 0.09
R5662:Ubr7 UTSW 12 102768267 missense probably benign 0.00
R5845:Ubr7 UTSW 12 102766312 missense probably damaging 0.99
R5867:Ubr7 UTSW 12 102761494 missense probably damaging 1.00
R6257:Ubr7 UTSW 12 102765840 nonsense probably null
R6543:Ubr7 UTSW 12 102768235 missense probably benign 0.01
R6849:Ubr7 UTSW 12 102758083 missense probably damaging 0.98
R7330:Ubr7 UTSW 12 102775712 missense probably damaging 0.99
R7576:Ubr7 UTSW 12 102769139 missense probably damaging 1.00
R8256:Ubr7 UTSW 12 102769911 missense probably damaging 1.00
R8334:Ubr7 UTSW 12 102758138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAATAGATCTGGGGCTTGAAATAG -3'
(R):5'- ATGAGAAGTTTGAGCCAGTCTC -3'

Sequencing Primer
(F):5'- GCTTGAAATAGTGGTTTTGACCC -3'
(R):5'- TGAGCCAGTCTCCATAATTAAAAGGC -3'
Posted On2018-06-22