Incidental Mutation 'R6601:Aox1'
ID525228
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Namealdehyde oxidase 1
SynonymsAox-1, Aox2, retinal oxidase, Aox-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location58029931-58106413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 58063506 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 527 (L527R)
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
Predicted Effect probably damaging
Transcript: ENSMUST00000001027
AA Change: L527R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: L527R

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160168
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58059044 missense probably damaging 1.00
IGL01077:Aox1 APN 1 58057410 splice site probably benign
IGL01335:Aox1 APN 1 58082153 nonsense probably null
IGL01410:Aox1 APN 1 58106025 splice site probably null
IGL01684:Aox1 APN 1 58077581 splice site probably null
IGL01727:Aox1 APN 1 58073228 nonsense probably null
IGL01805:Aox1 APN 1 58081513 missense possibly damaging 0.94
IGL01996:Aox1 APN 1 58082066 missense probably benign 0.11
IGL02060:Aox1 APN 1 58097955 missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58065340 missense probably benign 0.00
IGL02839:Aox1 APN 1 58068784 missense probably benign 0.05
IGL02975:Aox1 APN 1 58068391 missense probably damaging 1.00
IGL03062:Aox1 APN 1 58078465 missense probably benign 0.01
IGL03286:Aox1 APN 1 58049384 missense probably benign 0.19
IGL03335:Aox1 APN 1 58076160 missense probably damaging 0.98
IGL03395:Aox1 APN 1 58068725 splice site probably benign
R0048:Aox1 UTSW 1 58073212 missense probably damaging 0.98
R0144:Aox1 UTSW 1 58070074 missense probably benign 0.00
R0207:Aox1 UTSW 1 58105014 missense possibly damaging 0.82
R0357:Aox1 UTSW 1 58092516 missense probably damaging 1.00
R0383:Aox1 UTSW 1 58061241 missense probably benign 0.00
R0399:Aox1 UTSW 1 58068849 splice site probably null
R0465:Aox1 UTSW 1 58062207 missense probably damaging 1.00
R0480:Aox1 UTSW 1 58043651 splice site probably benign
R1005:Aox1 UTSW 1 58065352 missense probably benign 0.00
R1507:Aox1 UTSW 1 58104451 missense probably benign 0.01
R1597:Aox1 UTSW 1 58047167 missense probably damaging 1.00
R1693:Aox1 UTSW 1 58085542 missense probably damaging 1.00
R1709:Aox1 UTSW 1 58077474 missense probably benign
R1869:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1870:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1898:Aox1 UTSW 1 58078442 missense probably damaging 1.00
R1908:Aox1 UTSW 1 58102624 missense probably damaging 1.00
R2002:Aox1 UTSW 1 58047141 missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58059192 splice site probably null
R2065:Aox1 UTSW 1 58059192 splice site probably null
R2265:Aox1 UTSW 1 58081520 missense probably damaging 0.99
R3713:Aox1 UTSW 1 58056215 missense probably benign 0.01
R3778:Aox1 UTSW 1 58053703 missense possibly damaging 0.89
R4198:Aox1 UTSW 1 58085607 missense probably benign
R4296:Aox1 UTSW 1 58057400 splice site probably null
R4562:Aox1 UTSW 1 58059056 missense probably damaging 0.99
R4858:Aox1 UTSW 1 58104481 missense probably benign
R4862:Aox1 UTSW 1 58095157 missense probably damaging 0.98
R5048:Aox1 UTSW 1 58059482 splice site probably benign
R5127:Aox1 UTSW 1 58030026 missense probably benign 0.00
R5139:Aox1 UTSW 1 58061297 missense probably benign 0.03
R5157:Aox1 UTSW 1 58070063 missense probably damaging 1.00
R5168:Aox1 UTSW 1 58049402 missense probably damaging 1.00
R5186:Aox1 UTSW 1 58068370 missense probably damaging 1.00
R5235:Aox1 UTSW 1 58057555 missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58092558 missense probably damaging 0.99
R5466:Aox1 UTSW 1 58041460 missense probably damaging 1.00
R5540:Aox1 UTSW 1 58104410 missense probably benign 0.03
R5615:Aox1 UTSW 1 58096966 missense probably benign
R5652:Aox1 UTSW 1 58095197 missense probably damaging 1.00
R5920:Aox1 UTSW 1 58049472 missense probably damaging 1.00
R6008:Aox1 UTSW 1 58077513 missense probably damaging 1.00
R6073:Aox1 UTSW 1 58104509 critical splice donor site probably null
R6215:Aox1 UTSW 1 58085461 missense probably benign
R6403:Aox1 UTSW 1 58068435 missense probably damaging 1.00
R6440:Aox1 UTSW 1 58094472 missense probably damaging 1.00
R6608:Aox1 UTSW 1 58057546 missense probably benign 0.40
R6752:Aox1 UTSW 1 58047239 missense probably benign 0.00
R6989:Aox1 UTSW 1 58085452 missense probably damaging 1.00
R7042:Aox1 UTSW 1 58102600 missense probably damaging 0.99
R7442:Aox1 UTSW 1 58082013 missense probably damaging 1.00
R7506:Aox1 UTSW 1 58049403 missense probably damaging 1.00
R7563:Aox1 UTSW 1 58047145 missense probably benign 0.32
R7589:Aox1 UTSW 1 58041484 missense probably damaging 1.00
R7735:Aox1 UTSW 1 58068292 missense probably benign 0.01
R7814:Aox1 UTSW 1 58085467 missense probably benign
R7876:Aox1 UTSW 1 58062171 nonsense probably null
R7905:Aox1 UTSW 1 58104398 missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58106068 missense possibly damaging 0.68
R8116:Aox1 UTSW 1 58076124 missense probably damaging 1.00
R8179:Aox1 UTSW 1 58097958 missense probably damaging 1.00
R8264:Aox1 UTSW 1 58053714 missense possibly damaging 0.92
R8284:Aox1 UTSW 1 58076091 missense probably damaging 1.00
Z1088:Aox1 UTSW 1 58081542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAATTTGCCTTGGCTATCAGC -3'
(R):5'- GTCTGAGGCCTCCTTGGAATTC -3'

Sequencing Primer
(F):5'- GGCTATCAGCTGAACCTACCTG -3'
(R):5'- GAATTCTTCCTCAAAGTCCCAGC -3'
Posted On2018-06-22