Incidental Mutation 'R6601:Zfp612'
ID525269
Institutional Source Beutler Lab
Gene Symbol Zfp612
Ensembl Gene ENSMUSG00000044676
Gene Namezinc finger protein 612
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location110079746-110092741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 110089549 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 424 (Q424K)
Ref Sequence ENSEMBL: ENSMUSP00000062474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058804] [ENSMUST00000165700] [ENSMUST00000212754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058804
AA Change: Q424K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062474
Gene: ENSMUSG00000044676
AA Change: Q424K

DomainStartEndE-ValueType
KRAB 11 71 2e-32 SMART
low complexity region 135 146 N/A INTRINSIC
ZnF_C2H2 225 247 1.45e-2 SMART
ZnF_C2H2 253 275 2.67e-1 SMART
ZnF_C2H2 281 303 1.4e-4 SMART
ZnF_C2H2 309 331 2.91e-2 SMART
ZnF_C2H2 337 359 3.16e-3 SMART
ZnF_C2H2 365 387 4.17e-3 SMART
ZnF_C2H2 393 415 1.82e-3 SMART
ZnF_C2H2 421 443 3.69e-4 SMART
ZnF_C2H2 449 471 3.69e-4 SMART
ZnF_C2H2 477 499 1.58e-3 SMART
ZnF_C2H2 505 527 4.87e-4 SMART
ZnF_C2H2 533 555 1.38e-3 SMART
ZnF_C2H2 561 583 5.06e-2 SMART
ZnF_C2H2 589 611 5.9e-3 SMART
ZnF_C2H2 617 639 9.44e-2 SMART
ZnF_C2H2 645 667 1.03e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165700
Predicted Effect possibly damaging
Transcript: ENSMUST00000212754
AA Change: Q463K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Zfp612
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Zfp612 UTSW 8 110090038 missense probably damaging 1.00
R1920:Zfp612 UTSW 8 110088463 missense probably benign 0.03
R2994:Zfp612 UTSW 8 110089417 missense probably damaging 1.00
R4281:Zfp612 UTSW 8 110090059 missense probably damaging 0.98
R4378:Zfp612 UTSW 8 110089051 missense possibly damaging 0.92
R4492:Zfp612 UTSW 8 110089297 missense probably damaging 0.99
R4748:Zfp612 UTSW 8 110088672 missense probably benign 0.37
R4890:Zfp612 UTSW 8 110089944 nonsense probably null
R5200:Zfp612 UTSW 8 110089900 nonsense probably null
R5443:Zfp612 UTSW 8 110089595 missense possibly damaging 0.85
R5864:Zfp612 UTSW 8 110089726 missense probably damaging 1.00
R6177:Zfp612 UTSW 8 110089974 missense probably damaging 1.00
R6435:Zfp612 UTSW 8 110089320 missense probably damaging 0.99
R7082:Zfp612 UTSW 8 110089705 missense probably damaging 1.00
R7083:Zfp612 UTSW 8 110089136 missense probably damaging 1.00
RF007:Zfp612 UTSW 8 110089542 nonsense probably null
RF008:Zfp612 UTSW 8 110089561 missense probably damaging 1.00
Z1176:Zfp612 UTSW 8 110088863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACTGTGGGAAAGCCTTCAA -3'
(R):5'- TCCCACACTCGCTACATTGAT -3'

Sequencing Primer
(F):5'- CTGTGGGAAAGCCTTCAATGTTAACG -3'
(R):5'- ACTCGCTACATTGATACGGC -3'
Posted On2018-06-22