Incidental Mutation 'R6601:Taar9'
ID525277
Institutional Source Beutler Lab
Gene Symbol Taar9
Ensembl Gene ENSMUSG00000037424
Gene Nametrace amine-associated receptor 9
SynonymsTar3, Ta3, Trar3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location24108488-24109534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24109047 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 163 (Y163C)
Ref Sequence ENSEMBL: ENSMUSP00000043552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041180]
Predicted Effect probably damaging
Transcript: ENSMUST00000041180
AA Change: Y163C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043552
Gene: ENSMUSG00000037424
AA Change: Y163C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 326 7.3e-13 PFAM
Pfam:7tm_1 49 311 8.4e-61 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAAR9 is a member of a large family of rhodopsin G protein-coupled receptors (GPCRs, or GPRs). GPCRs contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins.[supplied by OMIM, Jul 2005]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Taar9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Taar9 APN 10 24109531 missense probably benign
IGL02011:Taar9 APN 10 24108579 missense possibly damaging 0.93
IGL02883:Taar9 APN 10 24109480 missense probably benign 0.08
R1468:Taar9 UTSW 10 24109484 missense possibly damaging 0.47
R1468:Taar9 UTSW 10 24109484 missense possibly damaging 0.47
R1598:Taar9 UTSW 10 24109407 missense possibly damaging 0.90
R2072:Taar9 UTSW 10 24108979 missense probably damaging 1.00
R2471:Taar9 UTSW 10 24109391 missense probably benign 0.00
R2519:Taar9 UTSW 10 24109254 missense probably damaging 1.00
R4205:Taar9 UTSW 10 24108579 missense possibly damaging 0.93
R4793:Taar9 UTSW 10 24109510 missense probably benign
R4801:Taar9 UTSW 10 24108843 missense probably damaging 0.97
R4802:Taar9 UTSW 10 24108843 missense probably damaging 0.97
R5457:Taar9 UTSW 10 24109105 missense probably damaging 0.98
R6450:Taar9 UTSW 10 24109240 missense probably damaging 1.00
R6915:Taar9 UTSW 10 24109012 missense possibly damaging 0.53
R7179:Taar9 UTSW 10 24108984 missense probably damaging 1.00
R7480:Taar9 UTSW 10 24108945 missense possibly damaging 0.61
R8200:Taar9 UTSW 10 24109419 missense probably damaging 0.99
Z1088:Taar9 UTSW 10 24108965 missense probably damaging 1.00
Z1177:Taar9 UTSW 10 24109141 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATAGCTCTCAGAGGAGGCCTG -3'
(R):5'- TCCACACGTGTTTCGACAC -3'

Sequencing Primer
(F):5'- TCAGAGGAGGCCTGAGCTTG -3'
(R):5'- ACGTGTTTCGACACCTCCTTCTG -3'
Posted On2018-06-22