Incidental Mutation 'R6681:Sorcs2'
ID527491
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Namesortilin-related VPS10 domain containing receptor 2
SynonymsVPS10 domain receptor protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6681 (G1)
Quality Score152.008
Status Validated
Chromosome5
Chromosomal Location36017180-36398139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36397810 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 79 (R79L)
Ref Sequence ENSEMBL: ENSMUSP00000065292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370] [ENSMUST00000070720]
Predicted Effect probably benign
Transcript: ENSMUST00000037370
AA Change: R79L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: R79L

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070720
AA Change: R79L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065292
Gene: ENSMUSG00000029093
AA Change: R79L

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
Blast:VPS10 170 213 2e-22 BLAST
low complexity region 214 227 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137040
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,121,798 T971S probably damaging Het
Catsperb C T 12: 101,624,735 Q1021* probably null Het
Ccdc62 A G 5: 123,934,093 T62A probably benign Het
Cuzd1 A G 7: 131,311,683 S402P probably damaging Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Dennd2c A G 3: 103,131,661 T42A probably benign Het
Dnah7a T C 1: 53,521,226 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpp4 A T 2: 62,348,549 F607L probably benign Het
Ech1 C T 7: 28,830,338 probably null Het
Fam53a A G 5: 33,607,840 L174P probably damaging Het
Fh1 T C 1: 175,619,124 D62G probably null Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gpatch11 T C 17: 78,840,099 I103T probably damaging Het
Hmgcll1 A T 9: 76,081,449 T169S probably benign Het
Kbtbd3 A T 9: 4,330,687 I354F probably benign Het
Kdm5b T C 1: 134,613,269 F700L possibly damaging Het
Mamdc4 C A 2: 25,567,744 G439V probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Mug1 C T 6: 121,838,724 S29L possibly damaging Het
Myh2 G A 11: 67,178,348 D328N probably damaging Het
Olfr1106 T C 2: 87,048,598 T213A probably benign Het
Olfr1404 C A 1: 173,216,406 H252N probably damaging Het
Olfr1450 A G 19: 12,954,459 Y290C probably damaging Het
Olfr969 T A 9: 39,795,414 I13N probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Rest A G 5: 77,280,997 K421R probably damaging Het
Rttn C A 18: 89,014,611 H668N probably damaging Het
Scn9a T C 2: 66,563,342 I228V possibly damaging Het
Scp2 G T 4: 108,091,316 Q155K probably damaging Het
Sec61a2 G A 2: 5,876,408 R18* probably null Het
Serpinb8 T A 1: 107,597,591 M41K probably damaging Het
Sgsm2 A T 11: 74,865,378 W382R probably damaging Het
Slc26a10 G T 10: 127,173,661 T606N possibly damaging Het
Slc30a6 T C 17: 74,404,032 I40T possibly damaging Het
Slfn5 G A 11: 82,956,378 E30K possibly damaging Het
Tmc5 G A 7: 118,669,304 S865N probably damaging Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Trpv5 C G 6: 41,653,354 E601Q probably damaging Het
Ttc39b A T 4: 83,240,048 probably benign Het
Ttll6 T A 11: 96,138,863 C201S probably damaging Het
Vezt A G 10: 93,996,997 V204A probably benign Het
Vmn1r45 T A 6: 89,934,003 probably benign Het
Zfp433 A T 10: 81,720,888 H408L probably damaging Het
Zfp865 T C 7: 5,029,451 I145T possibly damaging Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36037401 splice site probably null
IGL01064:Sorcs2 APN 5 36065352 missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36021252 missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36047809 missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36025942 missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36062552 missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36077957 missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36068148 missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36065331 unclassified probably benign
IGL03141:Sorcs2 APN 5 36065355 missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36031212 missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36046504 missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36153845 missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36397553 splice site probably benign
R0345:Sorcs2 UTSW 5 36027874 missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36031190 missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36065433 missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36024572 missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36027925 missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36026748 missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36229220 splice site probably benign
R1935:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36042086 splice site probably null
R3148:Sorcs2 UTSW 5 36035788 missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36397806 missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36397663 nonsense probably null
R4092:Sorcs2 UTSW 5 36025822 missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36037494 missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36043452 missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36039390 missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36031183 missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36046530 nonsense probably null
R5727:Sorcs2 UTSW 5 36031286 missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36229211 missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36229191 missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36029083 missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36019384 missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36027988 splice site probably null
R6290:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36077966 missense probably damaging 1.00
R7024:Sorcs2 UTSW 5 36021261 missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36068130 missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36025876 missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36397952 missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36027978 missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36397952 missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36043527 missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36229175 missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36024072 missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36024614 missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36062614 missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36062588 missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36038206 missense probably benign 0.00
RF063:Sorcs2 UTSW 5 36153811 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTCACTTACGCTGCTGTTC -3'
(R):5'- TTACCTACCAGCGACCATGG -3'

Sequencing Primer
(F):5'- TCTCCCTTGAGCACGAACG -3'
(R):5'- AAGCGTCCTGGCCCTACTG -3'
Posted On2018-07-23