Incidental Mutation 'R6692:Lypla2'
ID527907
Institutional Source Beutler Lab
Gene Symbol Lypla2
Ensembl Gene ENSMUSG00000028670
Gene Namelysophospholipase 2
Synonymslysophospholipase II, LysoII
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location135968224-135972626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 135970862 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 26 (A26S)
Ref Sequence ENSEMBL: ENSMUSP00000101478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067567] [ENSMUST00000102540] [ENSMUST00000102541] [ENSMUST00000105851] [ENSMUST00000105852]
Predicted Effect probably benign
Transcript: ENSMUST00000067567
AA Change: A26S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064204
Gene: ENSMUSG00000028670
AA Change: A26S

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 11 228 4.8e-89 PFAM
Pfam:Abhydrolase_5 26 211 2.6e-12 PFAM
Pfam:Abhydrolase_6 27 167 6.5e-13 PFAM
Pfam:Abhydrolase_3 80 170 3.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102540
SMART Domains Protein: ENSMUSP00000099599
Gene: ENSMUSG00000028671

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 1 194 1.9e-14 PFAM
Pfam:adh_short 2 142 4.4e-14 PFAM
Pfam:KR 3 146 3.6e-10 PFAM
Pfam:Polysacc_synt_2 4 193 8.8e-14 PFAM
Pfam:NAD_binding_10 4 213 1.1e-11 PFAM
Pfam:Epimerase 4 269 3.7e-55 PFAM
Pfam:3Beta_HSD 5 171 3.6e-18 PFAM
Pfam:NAD_binding_4 6 230 1.6e-11 PFAM
Pfam:Epimerase_Csub 282 343 3.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102541
SMART Domains Protein: ENSMUSP00000099600
Gene: ENSMUSG00000028671

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 1 184 3.5e-14 PFAM
Pfam:KR 3 144 9.5e-10 PFAM
Pfam:Polysacc_synt_2 4 193 7.6e-14 PFAM
Pfam:Epimerase 4 269 3.5e-54 PFAM
Pfam:3Beta_HSD 5 172 2e-18 PFAM
Pfam:GDP_Man_Dehyd 5 332 2.5e-60 PFAM
Pfam:NAD_binding_4 62 233 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105851
SMART Domains Protein: ENSMUSP00000101477
Gene: ENSMUSG00000028669

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:PITH 31 175 1.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105852
AA Change: A26S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101478
Gene: ENSMUSG00000028670
AA Change: A26S

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 11 228 2.3e-92 PFAM
Pfam:Abhydrolase_5 26 211 3.1e-12 PFAM
Pfam:Abhydrolase_6 27 225 1.2e-7 PFAM
Pfam:DLH 85 223 4.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156948
Meta Mutation Damage Score 0.1417 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. There are alternatively spliced transcript variants described for this gene but the full length nature is not known yet. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 C T 3: 107,675,085 G54D probably damaging Het
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Lypla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02089:Lypla2 APN 4 135969621 missense probably benign
R1353:Lypla2 UTSW 4 135970467 missense probably null 0.15
R2171:Lypla2 UTSW 4 135970604 splice site probably null
R4177:Lypla2 UTSW 4 135969092 unclassified probably benign
R8074:Lypla2 UTSW 4 135969801 critical splice donor site probably null
X0024:Lypla2 UTSW 4 135969175 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCACCCTGTGTCTCCAAG -3'
(R):5'- TAAACCAGGAAGGCTTCTCTC -3'

Sequencing Primer
(F):5'- AATGAGACAGGCAGGTCCCC -3'
(R):5'- AGGAAGGCTTCTCTCCCCTG -3'
Posted On2018-07-23