Incidental Mutation 'R6692:Ahcyl1'
ID527904
Institutional Source Beutler Lab
Gene Symbol Ahcyl1
Ensembl Gene ENSMUSG00000027893
Gene NameS-adenosylhomocysteine hydrolase-like 1
SynonymsAhcy-rs3, 1110034F20Rik, DCAL, IRBIT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6692 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location107663118-107696560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107675085 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 54 (G54D)
Ref Sequence ENSEMBL: ENSMUSP00000121510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029490] [ENSMUST00000153623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029490
AA Change: G101D

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029490
Gene: ENSMUSG00000027893
AA Change: G101D

DomainStartEndE-ValueType
Blast:AdoHcyase 10 40 1e-8 BLAST
low complexity region 61 87 N/A INTRINSIC
AdoHcyase 104 529 3.29e-266 SMART
AdoHcyase_NAD 289 450 6.69e-103 SMART
Predicted Effect unknown
Transcript: ENSMUST00000138091
AA Change: G39D
SMART Domains Protein: ENSMUSP00000117909
Gene: ENSMUSG00000027893
AA Change: G39D

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:AdoHcyase 43 168 2e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144864
Predicted Effect probably damaging
Transcript: ENSMUST00000153623
AA Change: G54D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121510
Gene: ENSMUSG00000027893
AA Change: G54D

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:AdoHcyase 56 210 4.7e-71 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with inositol 1,4,5-trisphosphate receptor, type 1 and may be involved in the conversion of S-adenosyl-L-homocysteine to L-homocysteine and adenosine. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display abnormal exocrine pancreas physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1b1 T C 4: 45,803,427 C322R probably damaging Het
Cdc14b T C 13: 64,215,563 I258V probably damaging Het
Cenph T C 13: 100,772,735 I55V probably benign Het
Cep290 T A 10: 100,569,144 probably null Het
Ces2b A G 8: 104,837,287 Y431C probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Cyp4f40 C G 17: 32,675,742 T427S possibly damaging Het
Exoc2 A G 13: 30,935,507 I137T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
G3bp1 T A 11: 55,493,509 D168E probably benign Het
Gm765 T G 6: 98,248,208 H38P possibly damaging Het
Impg2 T A 16: 56,252,333 L376H probably damaging Het
Kdm4d A T 9: 14,463,065 M499K probably benign Het
Lonp1 C T 17: 56,619,230 V426M probably damaging Het
Lypla2 C A 4: 135,970,862 A26S probably benign Het
Map3k13 T C 16: 21,905,237 V323A possibly damaging Het
Mov10 A G 3: 104,818,044 L83P probably damaging Het
Mphosph9 G T 5: 124,260,116 A1039D probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1117-ps1 A G 2: 87,308,992 T68A possibly damaging Het
Pde3a T A 6: 141,479,346 S623T probably damaging Het
Pld1 T A 3: 28,041,199 M227K probably benign Het
Rell1 T G 5: 63,937,867 K85N probably damaging Het
Rhbdf1 T C 11: 32,215,652 T93A probably damaging Het
Sccpdh T A 1: 179,684,227 M88K possibly damaging Het
Siae T G 9: 37,642,799 probably null Het
Slc22a16 G A 10: 40,603,905 E637K unknown Het
Stk19 C T 17: 34,824,794 G95S probably benign Het
Stpg2 G A 3: 139,522,977 probably null Het
Sult2a5 T A 7: 13,624,132 F30I probably damaging Het
Svil A G 18: 5,082,853 E748G probably damaging Het
Swap70 T A 7: 110,269,919 H306Q probably benign Het
Try10 G A 6: 41,357,821 G227D probably damaging Het
Ttn T C 2: 76,896,369 probably benign Het
Ttn T A 2: 76,919,092 H3871L probably benign Het
Vmn1r231 T C 17: 20,890,483 I57V possibly damaging Het
Vpreb1 A G 16: 16,868,802 S75P probably damaging Het
Zkscan5 A G 5: 145,221,084 probably null Het
Other mutations in Ahcyl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Ahcyl1 APN 3 107667694 missense probably damaging 1.00
IGL02957:Ahcyl1 APN 3 107667642 missense probably damaging 1.00
R0226:Ahcyl1 UTSW 3 107670270 nonsense probably null
R0670:Ahcyl1 UTSW 3 107671165 missense probably damaging 1.00
R1537:Ahcyl1 UTSW 3 107696189 missense probably benign
R1779:Ahcyl1 UTSW 3 107674103 missense probably benign
R2355:Ahcyl1 UTSW 3 107670217 missense probably damaging 1.00
R2369:Ahcyl1 UTSW 3 107670240 missense probably damaging 1.00
R4689:Ahcyl1 UTSW 3 107665518 nonsense probably null
R4712:Ahcyl1 UTSW 3 107667231 unclassified probably benign
R4721:Ahcyl1 UTSW 3 107669917 missense possibly damaging 0.89
R4996:Ahcyl1 UTSW 3 107668287 missense probably damaging 1.00
R5289:Ahcyl1 UTSW 3 107669890 critical splice donor site probably null
R6881:Ahcyl1 UTSW 3 107668109 missense probably damaging 1.00
R7502:Ahcyl1 UTSW 3 107671197 nonsense probably null
R7853:Ahcyl1 UTSW 3 107668288 missense probably benign 0.18
R7895:Ahcyl1 UTSW 3 107669151 missense probably damaging 0.99
R7936:Ahcyl1 UTSW 3 107668288 missense probably benign 0.18
R7978:Ahcyl1 UTSW 3 107669151 missense probably damaging 0.99
R8055:Ahcyl1 UTSW 3 107668731 missense probably benign 0.00
Z1177:Ahcyl1 UTSW 3 107673435 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCTCAGTTTCCATATAGAGAGAAG -3'
(R):5'- ATGACGTAAAAGGGACCTGC -3'

Sequencing Primer
(F):5'- GTGTTTATCCAAAGTGTGAGAAACTC -3'
(R):5'- GGACCTGCAATTAAAAGTGTTCGC -3'
Posted On2018-07-23